Incidental Mutation 'R5561:Lcp1'
ID 436626
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75449948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 386 (D386N)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000124499
AA Change: D386N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: D386N

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131802
AA Change: D386N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: D386N

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145303
AA Change: D386N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: D386N

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTTGCAGGAGAAGGATGAC -3'
(R):5'- AGTAGCGGACAATGCCTATG -3'

Sequencing Primer
(F):5'- CATCCAGAGGGCAGAGTGC -3'
(R):5'- GCGGACAATGCCTATGTATAATG -3'
Posted On 2016-10-24