Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Uggt2'

436628

Institutional Source

Beutler Lab

Gene Symbol

Uggt2

Ensembl Gene

ENSMUSG00000042104

Gene Name

UDP-glucose glycoprotein glucosyltransferase 2

Synonyms

3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik

MMRRC Submission

043118-MU

Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118985039-119099430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119041527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 856 (R856Q)

Ref Sequence

ENSEMBL: ENSMUSP00000121249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]

AlphaFold

E9Q4X2

Predicted Effect

probably benign
Transcript: ENSMUST00000127153
AA Change: R380Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104
AA Change: R380Q

Domain	Start	End	E-Value	Type
low complexity region	327	334	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138923

Predicted Effect

probably benign
Transcript: ENSMUST00000156203
AA Change: R856Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: R856Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDP-g_GGTase	23	1189	N/A	PFAM
SCOP:d1ga8a_	1219	1485	9e-44	SMART
Blast:BROMO	1377	1427	4e-16	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Uggt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Uggt2	APN	14	119049276	missense	possibly damaging	0.94
IGL00430:Uggt2	APN	14	119026429	nonsense	probably null
IGL00433:Uggt2	APN	14	119013487	missense	probably benign
IGL00572:Uggt2	APN	14	119042791	missense	probably benign	0.02
IGL00577:Uggt2	APN	14	119034900	missense	possibly damaging	0.89
IGL00671:Uggt2	APN	14	119042799	missense	possibly damaging	0.73
IGL01482:Uggt2	APN	14	119057645	missense	probably damaging	1.00
IGL01630:Uggt2	APN	14	119042772	missense	probably benign	0.00
IGL01787:Uggt2	APN	14	119081734	missense	probably damaging	0.99
IGL02063:Uggt2	APN	14	119089193	missense	possibly damaging	0.79
IGL02809:Uggt2	APN	14	119090738	missense	probably benign	0.17
IGL02894:Uggt2	APN	14	119081799	missense	probably damaging	0.96
IGL03062:Uggt2	APN	14	119075346	missense	probably damaging	1.00
IGL03139:Uggt2	APN	14	119095310	missense	probably benign	0.25
IGL03142:Uggt2	APN	14	118998191	missense	probably damaging	1.00
IGL03168:Uggt2	APN	14	119077668	missense	probably damaging	0.98
IGL03348:Uggt2	APN	14	119070888	missense	probably benign	0.38
P0014:Uggt2	UTSW	14	119044538	missense	probably damaging	1.00
R0006:Uggt2	UTSW	14	119049663	missense	probably benign	0.07
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0383:Uggt2	UTSW	14	119049451	missense	probably damaging	1.00
R0433:Uggt2	UTSW	14	119075329	critical splice donor site	probably null
R0472:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0609:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0645:Uggt2	UTSW	14	119057598	missense	probably benign	0.27
R0788:Uggt2	UTSW	14	119095400	splice site	probably benign
R0940:Uggt2	UTSW	14	119091192	critical splice donor site	probably null
R1567:Uggt2	UTSW	14	119009093	missense	possibly damaging	0.58
R1627:Uggt2	UTSW	14	119057663	missense	possibly damaging	0.95
R1682:Uggt2	UTSW	14	119054643	missense	probably benign	0.19
R1746:Uggt2	UTSW	14	119013503	missense	probably benign	0.00
R1785:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1786:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1799:Uggt2	UTSW	14	119032276	missense	probably benign	0.00
R1894:Uggt2	UTSW	14	119049718	missense	probably damaging	0.99
R1918:Uggt2	UTSW	14	119008055	splice site	probably benign
R2149:Uggt2	UTSW	14	119075345	missense	probably benign	0.02
R2168:Uggt2	UTSW	14	119019505	missense	probably damaging	1.00
R2219:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2220:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2240:Uggt2	UTSW	14	118995049	missense	probably damaging	1.00
R2331:Uggt2	UTSW	14	119026599	missense	possibly damaging	0.87
R2904:Uggt2	UTSW	14	119059109	missense	possibly damaging	0.74
R2906:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2907:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2908:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2998:Uggt2	UTSW	14	119049385	missense	probably damaging	1.00
R3407:Uggt2	UTSW	14	119091270	missense	probably benign	0.39
R3722:Uggt2	UTSW	14	119041518	missense	probably damaging	1.00
R3749:Uggt2	UTSW	14	119057672	missense	probably benign	0.13
R4015:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4016:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4017:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4206:Uggt2	UTSW	14	119049262	missense	probably damaging	1.00
R4536:Uggt2	UTSW	14	119019558	missense	probably benign
R4642:Uggt2	UTSW	14	119034935	missense	probably benign	0.00
R4654:Uggt2	UTSW	14	119032258	missense	possibly damaging	0.46
R4770:Uggt2	UTSW	14	119029054	splice site	probably null
R4810:Uggt2	UTSW	14	119013521	missense	probably damaging	1.00
R4832:Uggt2	UTSW	14	119001847	missense	probably damaging	0.99
R4856:Uggt2	UTSW	14	119035964	splice site	probably null
R4886:Uggt2	UTSW	14	119035964	splice site	probably null
R4888:Uggt2	UTSW	14	119049253	missense	probably damaging	1.00
R4888:Uggt2	UTSW	14	119077650	critical splice donor site	probably null
R4895:Uggt2	UTSW	14	119018886	missense	probably damaging	1.00
R5353:Uggt2	UTSW	14	119081770	missense	probably benign	0.00
R5423:Uggt2	UTSW	14	119019486	missense	probably damaging	1.00
R5476:Uggt2	UTSW	14	119090709	missense	probably benign	0.01
R5607:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5608:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5625:Uggt2	UTSW	14	119077724	missense	probably damaging	1.00
R5698:Uggt2	UTSW	14	119042726	missense	probably damaging	1.00
R5986:Uggt2	UTSW	14	119049426	missense	probably damaging	1.00
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6056:Uggt2	UTSW	14	119035969	critical splice donor site	probably null
R6289:Uggt2	UTSW	14	119041602	missense	probably damaging	0.99
R6480:Uggt2	UTSW	14	119057564	missense	probably benign	0.01
R6515:Uggt2	UTSW	14	119077719	missense	possibly damaging	0.89
R6706:Uggt2	UTSW	14	119070881	missense	probably damaging	1.00
R6745:Uggt2	UTSW	14	119042610	missense	possibly damaging	0.58
R6819:Uggt2	UTSW	14	119026435	missense	probably damaging	1.00
R6879:Uggt2	UTSW	14	119001859	missense	probably benign	0.10
R7117:Uggt2	UTSW	14	119014526	missense	probably benign	0.25
R7183:Uggt2	UTSW	14	119019637	splice site	probably null
R7337:Uggt2	UTSW	14	119086175	missense	probably benign	0.28
R7342:Uggt2	UTSW	14	118994972	missense	possibly damaging	0.56
R7615:Uggt2	UTSW	14	119089269	missense	probably benign	0.12
R7625:Uggt2	UTSW	14	119026493	missense	probably damaging	1.00
R7685:Uggt2	UTSW	14	119075347	missense	probably damaging	1.00
R7842:Uggt2	UTSW	14	118998104	missense	probably damaging	1.00
R7891:Uggt2	UTSW	14	119042647	missense	probably benign	0.09
R7938:Uggt2	UTSW	14	119059107	missense	possibly damaging	0.68
R8050:Uggt2	UTSW	14	119026422	missense	probably damaging	0.98
R9007:Uggt2	UTSW	14	119089312	missense	probably damaging	1.00
R9080:Uggt2	UTSW	14	119057605	missense	probably benign	0.42
R9203:Uggt2	UTSW	14	119057563	missense	probably benign	0.08
R9215:Uggt2	UTSW	14	119041594	missense	probably damaging	1.00
R9324:Uggt2	UTSW	14	119075329	critical splice donor site	probably null
R9459:Uggt2	UTSW	14	119049183	missense	probably benign	0.02
R9647:Uggt2	UTSW	14	119018900	missense	probably damaging	1.00
R9781:Uggt2	UTSW	14	118994972	missense	possibly damaging	0.56
Z1177:Uggt2	UTSW	14	119007296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGAAGGTGTTGTCGCAG -3'
(R):5'- GGCTTTGTGAATGATTTGGCAAAAG -3'

Sequencing Primer
(F):5'- GCACAGTGGGTTCTTGCATCATC -3'
(R):5'- GTGAATGATTTGGCAAAAGAGTATC -3'

Posted On

2016-10-24