Incidental Mutation 'R5561:Trabd'
ID 436630
Institutional Source Beutler Lab
Gene Symbol Trabd
Ensembl Gene ENSMUSG00000015363
Gene Name TraB domain containing
Synonyms 5730502D15Rik
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 88960267-88971278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88966187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 48 (M48T)
Ref Sequence ENSEMBL: ENSMUSP00000128721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081702] [ENSMUST00000165690] [ENSMUST00000168863] [ENSMUST00000169870] [ENSMUST00000169891]
AlphaFold Q99JY4
Predicted Effect probably benign
Transcript: ENSMUST00000081702
AA Change: M48T

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080403
Gene: ENSMUSG00000015363
AA Change: M48T

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 367 8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163696
Predicted Effect probably benign
Transcript: ENSMUST00000165690
AA Change: M48T

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131228
Gene: ENSMUSG00000015363
AA Change: M48T

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 310 9.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168863
AA Change: M48T

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130292
Gene: ENSMUSG00000015363
AA Change: M48T

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 235 1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169870
Predicted Effect probably benign
Transcript: ENSMUST00000169891
AA Change: M48T

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128721
Gene: ENSMUSG00000015363
AA Change: M48T

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Pfam:TraB 63 276 8.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Trabd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Trabd APN 15 88,968,998 (GRCm39) missense probably benign 0.01
R0355:Trabd UTSW 15 88,969,816 (GRCm39) missense possibly damaging 0.53
R0603:Trabd UTSW 15 88,966,929 (GRCm39) missense probably damaging 1.00
R1658:Trabd UTSW 15 88,970,069 (GRCm39) splice site probably null
R1806:Trabd UTSW 15 88,969,824 (GRCm39) missense possibly damaging 0.96
R1883:Trabd UTSW 15 88,966,184 (GRCm39) missense probably damaging 0.98
R2015:Trabd UTSW 15 88,968,929 (GRCm39) missense possibly damaging 0.55
R4507:Trabd UTSW 15 88,969,833 (GRCm39) missense probably damaging 0.97
R4653:Trabd UTSW 15 88,970,042 (GRCm39) missense probably damaging 1.00
R4842:Trabd UTSW 15 88,966,915 (GRCm39) missense probably benign 0.33
R5364:Trabd UTSW 15 88,967,007 (GRCm39) splice site probably benign
R7378:Trabd UTSW 15 88,969,493 (GRCm39) missense possibly damaging 0.56
R7843:Trabd UTSW 15 88,966,157 (GRCm39) missense possibly damaging 0.94
R8157:Trabd UTSW 15 88,970,024 (GRCm39) missense probably damaging 1.00
R8331:Trabd UTSW 15 88,969,131 (GRCm39) missense probably damaging 0.99
R8353:Trabd UTSW 15 88,969,616 (GRCm39) missense possibly damaging 0.69
R8443:Trabd UTSW 15 88,970,107 (GRCm39) missense probably benign 0.41
R8453:Trabd UTSW 15 88,969,616 (GRCm39) missense possibly damaging 0.69
R8739:Trabd UTSW 15 88,969,152 (GRCm39) missense probably damaging 1.00
R8850:Trabd UTSW 15 88,969,667 (GRCm39) splice site probably benign
R9021:Trabd UTSW 15 88,968,913 (GRCm39) missense possibly damaging 0.46
R9425:Trabd UTSW 15 88,969,496 (GRCm39) missense probably damaging 1.00
Z1177:Trabd UTSW 15 88,969,139 (GRCm39) missense probably damaging 1.00
Z1177:Trabd UTSW 15 88,960,798 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCTCACCTAACTGGAAAGGGTC -3'
(R):5'- CAGACTGGCAGAAGCATAGC -3'

Sequencing Primer
(F):5'- CCTAACTGGAAAGGGTCTGTCAC -3'
(R):5'- ACCACCTGTAATGAGATCTGGTGC -3'
Posted On 2016-10-24