Incidental Mutation 'R5561:Morc1'
ID 436631
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Name microrchidia 1
Synonyms
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 48431237-48630900 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 48449348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 89 (L89F)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
AlphaFold Q9WVL5
Predicted Effect probably benign
Transcript: ENSMUST00000023330
AA Change: L89F

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: L89F

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48612326 missense probably damaging 0.98
IGL00815:Morc1 APN 16 48460692 missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48452589 missense probably damaging 0.99
IGL01321:Morc1 APN 16 48582462 missense probably benign 0.00
IGL01410:Morc1 APN 16 48612314 missense probably benign 0.16
IGL01557:Morc1 APN 16 48498766 missense probably damaging 1.00
IGL02118:Morc1 APN 16 48587104 missense probably benign 0.01
IGL02626:Morc1 APN 16 48615760 missense probably damaging 0.96
IGL02692:Morc1 APN 16 48510233 missense probably null 0.95
IGL02812:Morc1 APN 16 48558506 splice site probably benign
IGL03232:Morc1 APN 16 48630802 missense probably benign 0.06
IGL03331:Morc1 APN 16 48612368 splice site probably benign
IGL03408:Morc1 APN 16 48442412 missense probably damaging 1.00
R0545:Morc1 UTSW 16 48565657 missense probably benign 0.05
R0569:Morc1 UTSW 16 48587122 missense probably benign 0.02
R0699:Morc1 UTSW 16 48592614 missense probably benign 0.01
R1717:Morc1 UTSW 16 48452477 missense probably benign 0.01
R1728:Morc1 UTSW 16 48612297 missense probably benign 0.10
R1803:Morc1 UTSW 16 48622638 missense probably benign 0.14
R1864:Morc1 UTSW 16 48592530 missense probably benign 0.01
R2008:Morc1 UTSW 16 48565646 missense probably benign 0.41
R2070:Morc1 UTSW 16 48592611 missense probably benign 0.00
R2071:Morc1 UTSW 16 48592611 missense probably benign 0.00
R4851:Morc1 UTSW 16 48561617 missense probably benign 0.02
R5013:Morc1 UTSW 16 48502336 missense probably benign 0.11
R5081:Morc1 UTSW 16 48502352 missense probably benign 0.01
R5259:Morc1 UTSW 16 48630769 missense probably benign 0.12
R5342:Morc1 UTSW 16 48618509 missense probably damaging 0.99
R5481:Morc1 UTSW 16 48561485 splice site probably null
R6356:Morc1 UTSW 16 48437289 missense probably damaging 1.00
R6526:Morc1 UTSW 16 48587124 nonsense probably null
R6743:Morc1 UTSW 16 48502320 missense probably damaging 0.98
R6940:Morc1 UTSW 16 48479845 nonsense probably null
R6994:Morc1 UTSW 16 48565621 missense probably benign 0.00
R6994:Morc1 UTSW 16 48618546 missense probably benign 0.39
R7009:Morc1 UTSW 16 48627070 missense possibly damaging 0.69
R7346:Morc1 UTSW 16 48630900 splice site probably null
R7357:Morc1 UTSW 16 48622590 missense probably benign 0.14
R7448:Morc1 UTSW 16 48431345 missense probably damaging 0.97
R7840:Morc1 UTSW 16 48498784 missense probably benign 0.03
R8417:Morc1 UTSW 16 48460740 missense probably damaging 0.99
X0013:Morc1 UTSW 16 48587068 missense probably benign 0.04
X0027:Morc1 UTSW 16 48498811 missense probably damaging 1.00
Z1176:Morc1 UTSW 16 48587058 missense probably benign 0.03
Z1177:Morc1 UTSW 16 48565706 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTTGTGGACTGTCCCAAAG -3'
(R):5'- TTTTCATGTTGCAAAGAGCTGCG -3'

Sequencing Primer
(F):5'- TGGACTGTCCCAAAGGCTATG -3'
(R):5'- TGCAAAGAGCTGCGTCAGTTATG -3'
Posted On 2016-10-24