Incidental Mutation 'R5561:Fer'
ID 436635
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Name fer (fms/fps related) protein kinase
Synonyms Fert, Fert2
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 63896018-64139494 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 64037585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 246 (Y246*)
Ref Sequence ENSEMBL: ENSMUSP00000037418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129] [ENSMUST00000038080]
AlphaFold P70451
Predicted Effect probably null
Transcript: ENSMUST00000000129
AA Change: Y616*
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127
AA Change: Y616*

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000038080
AA Change: Y246*
SMART Domains Protein: ENSMUSP00000037418
Gene: ENSMUSG00000000127
AA Change: Y246*

DomainStartEndE-ValueType
SH2 89 168 5.9e-30 SMART
TyrKc 194 445 6.69e-148 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64037626 missense probably damaging 1.00
IGL02004:Fer APN 17 63924179 critical splice donor site probably null
IGL02103:Fer APN 17 64138928 missense probably benign 0.02
IGL02157:Fer APN 17 64138899 missense probably benign 0.03
IGL02217:Fer APN 17 64138965 missense probably benign 0.00
IGL02376:Fer APN 17 63934346 missense possibly damaging 0.69
IGL02955:Fer APN 17 63991717 critical splice donor site probably null
IGL02967:Fer APN 17 63896267 missense possibly damaging 0.69
IGL03392:Fer APN 17 63991642 missense probably damaging 0.97
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0207:Fer UTSW 17 63896278 missense probably damaging 1.00
R0243:Fer UTSW 17 64078946 missense probably benign 0.00
R0309:Fer UTSW 17 64139016 makesense probably null
R0384:Fer UTSW 17 63924184 splice site probably benign
R0634:Fer UTSW 17 64035508 missense probably benign 0.40
R1885:Fer UTSW 17 64138914 missense probably damaging 0.96
R1939:Fer UTSW 17 63973128 missense probably damaging 1.00
R2427:Fer UTSW 17 63957303 missense probably benign
R2504:Fer UTSW 17 63991580 splice site probably null
R4301:Fer UTSW 17 64078910 missense probably damaging 1.00
R4404:Fer UTSW 17 63941289 critical splice acceptor site probably null
R4418:Fer UTSW 17 64029291 missense possibly damaging 0.89
R4812:Fer UTSW 17 63934297 missense probably benign
R5724:Fer UTSW 17 63924157 missense probably damaging 1.00
R5936:Fer UTSW 17 63924063 missense probably benign
R6157:Fer UTSW 17 64078885 missense probably damaging 1.00
R6848:Fer UTSW 17 63991606 missense probably damaging 1.00
R7175:Fer UTSW 17 63924095 missense probably benign 0.01
R7198:Fer UTSW 17 63921688 missense possibly damaging 0.84
R7438:Fer UTSW 17 64133521 missense possibly damaging 0.91
R7723:Fer UTSW 17 63896278 missense probably damaging 1.00
R7949:Fer UTSW 17 64133508 missense probably damaging 1.00
R8064:Fer UTSW 17 63907423 missense probably benign 0.04
R8472:Fer UTSW 17 63973149 missense probably benign 0.00
R9032:Fer UTSW 17 63921772 missense probably damaging 0.99
R9085:Fer UTSW 17 63921772 missense probably damaging 0.99
R9358:Fer UTSW 17 63973081 missense possibly damaging 0.79
R9452:Fer UTSW 17 63924072 missense probably benign
R9608:Fer UTSW 17 63907332 missense probably benign
R9747:Fer UTSW 17 63907381 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTCATTTGCATTTGTGATGTACC -3'
(R):5'- AGACTCCTTGGACTCTTTACAAGG -3'

Sequencing Primer
(F):5'- GTACCATCCATATTTATCAATGC -3'
(R):5'- CCTTGGACTCTTTACAAGGAAATATC -3'
Posted On 2016-10-24