Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Spire1'

436638

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

043118-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67506646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 266 (N266Y)

Ref Sequence

ENSEMBL: ENSMUSP00000049336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

AlphaFold

Q52KF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000045105
AA Change: N266Y

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: N266Y

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000082243
AA Change: N279Y

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: N279Y

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115050
AA Change: N279Y

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: N279Y

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224122

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224799
AA Change: N196Y

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	splice site	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
R8111:Spire1	UTSW	18	67519321	missense	probably damaging	0.98
R8675:Spire1	UTSW	18	67491308	missense	possibly damaging	0.48
R8946:Spire1	UTSW	18	67496616	missense	probably damaging	1.00
R9441:Spire1	UTSW	18	67519392	missense	probably benign	0.41
R9706:Spire1	UTSW	18	67503438	missense	probably benign	0.39
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CAGTAACTAATCTCCCTGCGAGC -3'
(R):5'- CATGGAAATGCTGTCACCTGG -3'

Sequencing Primer
(F):5'- TACCTTCACAGACTGGAACTTAGAG -3'
(R):5'- GGTTGTGCTTCCAACACAG -3'

Posted On

2016-10-24