Incidental Mutation 'R0006:Wbp2'
ID43664
Institutional Source Beutler Lab
Gene Symbol Wbp2
Ensembl Gene ENSMUSG00000034341
Gene NameWW domain binding protein 2
Synonyms
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0006 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location116078573-116086995 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 116079788 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106444] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000153408] [ENSMUST00000156545] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably null
Transcript: ENSMUST00000074628
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106444
SMART Domains Protein: ENSMUSP00000102052
Gene: ENSMUSG00000034341

DomainStartEndE-ValueType
Pfam:GRAM 1 84 2.3e-19 PFAM
Pfam:WWbp 100 212 5.3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146339
Predicted Effect probably null
Transcript: ENSMUST00000153408
SMART Domains Protein: ENSMUSP00000115327
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155120
Predicted Effect probably null
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein that is a transcriptional coactivator of estrogen receptor alpha and progesterone receptor. Defects in this gene have been associated with hearing impairment. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a null allele show progressive high-frequency hearing loss, raised auditory brainstem response (ABR) thresholds, reduced ABR amplitudes, swelling of afferent terminals, inner hair cell synapse defects, and altered expression of AMPA receptor subunits and post-synaptic proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Wbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Wbp2 APN 11 116081240 missense possibly damaging 0.46
R0565:Wbp2 UTSW 11 116082385 missense possibly damaging 0.80
R1510:Wbp2 UTSW 11 116086882 missense probably benign 0.03
R1733:Wbp2 UTSW 11 116083883 missense probably benign 0.10
R1968:Wbp2 UTSW 11 116082365 missense possibly damaging 0.90
R1989:Wbp2 UTSW 11 116080221 critical splice donor site probably null
R2109:Wbp2 UTSW 11 116080619 nonsense probably null
R2264:Wbp2 UTSW 11 116079598 critical splice acceptor site probably null
R3079:Wbp2 UTSW 11 116079708 unclassified probably null
R4239:Wbp2 UTSW 11 116080547 unclassified probably benign
R4647:Wbp2 UTSW 11 116082381 missense probably benign 0.01
R4831:Wbp2 UTSW 11 116080637 nonsense probably null
R6146:Wbp2 UTSW 11 116083902 missense probably benign 0.07
R6367:Wbp2 UTSW 11 116083915 missense probably benign 0.36
R6455:Wbp2 UTSW 11 116079753 missense probably damaging 0.98
R6823:Wbp2 UTSW 11 116086910 missense probably benign 0.41
Z1088:Wbp2 UTSW 11 116086913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAGCTGTGCTGGCTTCCAAC -3'
(R):5'- AGCCTGGTGGTGAAGAGCTATATCC -3'

Sequencing Primer
(F):5'- GCTTCCAACGCCAGCTC -3'
(R):5'- TCTATCCCAGGTGCCACAG -3'
Posted On2013-05-29