Incidental Mutation 'R5562:Efhc1'
ID436641
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene NameEF-hand domain (C-terminal) containing 1
SynonymsmRib72-1, myoclonin1, 1700029F22Rik
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location20951626-20990841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20972880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 341 (T341I)
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447]
Predicted Effect probably damaging
Transcript: ENSMUST00000038447
AA Change: T341I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809
AA Change: T341I

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 20979481 nonsense probably null
IGL00549:Efhc1 APN 1 20979481 nonsense probably null
IGL01611:Efhc1 APN 1 20990687 makesense probably null
IGL01916:Efhc1 APN 1 20978749 missense probably damaging 1.00
IGL02366:Efhc1 APN 1 20960262 missense probably damaging 0.99
IGL02567:Efhc1 APN 1 20972964 missense probably damaging 0.98
IGL02590:Efhc1 APN 1 20967384 missense probably damaging 1.00
IGL02869:Efhc1 APN 1 20967343 missense probably damaging 0.96
IGL03264:Efhc1 APN 1 20967491 missense probably benign
IGL03292:Efhc1 APN 1 20960272 missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 20972825 missense probably damaging 1.00
P0023:Efhc1 UTSW 1 20955527 missense probably benign
R0180:Efhc1 UTSW 1 20967489 missense probably benign
R0220:Efhc1 UTSW 1 20967358 missense probably damaging 0.98
R0391:Efhc1 UTSW 1 20960188 missense probably damaging 1.00
R0765:Efhc1 UTSW 1 20978652 missense probably benign 0.00
R1293:Efhc1 UTSW 1 20978772 missense probably damaging 0.96
R1414:Efhc1 UTSW 1 20961289 missense probably damaging 1.00
R1644:Efhc1 UTSW 1 20967401 nonsense probably null
R1799:Efhc1 UTSW 1 20979538 missense probably benign 0.00
R1932:Efhc1 UTSW 1 20967400 missense probably damaging 1.00
R1991:Efhc1 UTSW 1 20989560 nonsense probably null
R2103:Efhc1 UTSW 1 20989560 nonsense probably null
R3956:Efhc1 UTSW 1 20978666 missense probably damaging 0.96
R4812:Efhc1 UTSW 1 20990647 missense probably damaging 0.99
R5064:Efhc1 UTSW 1 20974963 missense possibly damaging 0.91
R5800:Efhc1 UTSW 1 20978781 missense probably benign 0.00
R5948:Efhc1 UTSW 1 20972828 missense probably damaging 0.99
R5977:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R6313:Efhc1 UTSW 1 20979428 missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 20972940 missense probably benign 0.05
R6512:Efhc1 UTSW 1 20960349 missense probably damaging 0.99
R6530:Efhc1 UTSW 1 20961142 splice site probably null
R6865:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R7398:Efhc1 UTSW 1 20989520 missense probably benign
R7656:Efhc1 UTSW 1 20961057 intron probably null
R7676:Efhc1 UTSW 1 20967369 missense probably damaging 1.00
R7719:Efhc1 UTSW 1 20979520 missense probably benign
R7775:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7778:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7824:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7857:Efhc1 UTSW 1 20975002 missense probably benign 0.11
R7940:Efhc1 UTSW 1 20975002 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTCAGCTCTCATGTCAAGC -3'
(R):5'- CTACTTTCATAGAGTGATGGGCTC -3'

Sequencing Primer
(F):5'- AGCTCTCATGTCAAGCTTTCTTTTC -3'
(R):5'- CATAGAGTGATGGGCTCTGTATTTC -3'
Posted On2016-10-24