Incidental Mutation 'R5562:Olfr1133'
ID436649
Institutional Source Beutler Lab
Gene Symbol Olfr1133
Ensembl Gene ENSMUSG00000075155
Gene Nameolfactory receptor 1133
SynonymsGA_x6K02T2Q125-49151278-49150337, MOR176-2
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87645180-87647374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87645719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000149460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099855] [ENSMUST00000217368]
Predicted Effect probably benign
Transcript: ENSMUST00000099855
AA Change: I135V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097441
Gene: ENSMUSG00000075155
AA Change: I135V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:7tm_4 32 308 7e-51 PFAM
Pfam:7tm_1 42 291 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118805
Predicted Effect probably benign
Transcript: ENSMUST00000217368
AA Change: I135V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Olfr1133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1133 APN 2 87645286 missense probably damaging 1.00
IGL03354:Olfr1133 APN 2 87645595 missense probably damaging 0.99
PIT4366001:Olfr1133 UTSW 2 87645190 nonsense probably null
R1375:Olfr1133 UTSW 2 87645737 missense probably damaging 1.00
R1413:Olfr1133 UTSW 2 87645838 missense probably benign 0.02
R2011:Olfr1133 UTSW 2 87645889 missense probably damaging 0.97
R2016:Olfr1133 UTSW 2 87646052 missense probably benign 0.18
R2026:Olfr1133 UTSW 2 87645409 missense probably damaging 1.00
R2106:Olfr1133 UTSW 2 87645551 missense probably damaging 1.00
R4393:Olfr1133 UTSW 2 87645912 nonsense probably null
R5292:Olfr1133 UTSW 2 87645995 missense probably damaging 1.00
R5631:Olfr1133 UTSW 2 87645608 missense probably benign 0.16
R5632:Olfr1133 UTSW 2 87645229 missense probably damaging 1.00
R6801:Olfr1133 UTSW 2 87645323 missense probably benign 0.23
R7014:Olfr1133 UTSW 2 87645976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACAATGCTACACCCTACC -3'
(R):5'- TCTCCAAAGATGCTGGCTG -3'

Sequencing Primer
(F):5'- CATTGATGGATGTATCTGAGCAG -3'
(R):5'- CCAAAGATGCTGGCTGATTTC -3'
Posted On2016-10-24