Incidental Mutation 'R5562:Alkbh3'
ID436650
Institutional Source Beutler Lab
Gene Symbol Alkbh3
Ensembl Gene ENSMUSG00000040174
Gene NamealkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
SynonymsmABH3, 1700108H04Rik, 1810020C19Rik, Abh3
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location93980550-94010807 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 93996379 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]
Predicted Effect probably damaging
Transcript: ENSMUST00000040005
AA Change: L158Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174
AA Change: L158Q

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 89 275 2e-34 PFAM
Pfam:2OG-FeII_Oxy 172 277 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111240
AA Change: L159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: L159Q

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 276 3.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126378
AA Change: L159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: L159Q

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 202 8.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138046
Predicted Effect probably null
Transcript: ENSMUST00000183110
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Alkbh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Alkbh3 APN 2 94003051 critical splice donor site probably null
IGL01940:Alkbh3 APN 2 93981595 missense probably damaging 0.98
IGL02554:Alkbh3 APN 2 93996347 missense probably damaging 1.00
IGL02638:Alkbh3 APN 2 94008113 missense probably benign 0.02
IGL02640:Alkbh3 APN 2 93996361 missense possibly damaging 0.90
R0409:Alkbh3 UTSW 2 94001448 missense possibly damaging 0.84
R0437:Alkbh3 UTSW 2 93981569 missense probably damaging 1.00
R1456:Alkbh3 UTSW 2 94001419 splice site probably null
R1592:Alkbh3 UTSW 2 94008424 intron probably null
R2359:Alkbh3 UTSW 2 94008113 missense probably benign 0.01
R3109:Alkbh3 UTSW 2 94004763 missense probably damaging 1.00
R4297:Alkbh3 UTSW 2 94008124 missense probably benign
R6216:Alkbh3 UTSW 2 94008536 start gained probably benign
R7088:Alkbh3 UTSW 2 94004752 missense possibly damaging 0.55
R7711:Alkbh3 UTSW 2 94008092 missense probably benign
R8014:Alkbh3 UTSW 2 94001513 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCGAGTGGCACCAAAACTG -3'
(R):5'- CTTTGTGAGGACATGCACTGC -3'

Sequencing Primer
(F):5'- CACCAAAACTGAGGGAAGCAATGAC -3'
(R):5'- GTAGACAGCTCCAGCCTTCAG -3'
Posted On2016-10-24