Incidental Mutation 'R5562:Prnp'
ID436651
Institutional Source Beutler Lab
Gene Symbol Prnp
Ensembl Gene ENSMUSG00000079037
Gene Nameprion protein
SynonymsPrPC, Sinc, Prn-i, PrP, CD230, Prn-p, PrPSc
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131909928-131938429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131937031 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000088833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091288] [ENSMUST00000124100] [ENSMUST00000136783]
PDB Structure
PRION PROTEIN DOMAIN PRP(121-231) FROM MOUSE, NMR, 2 MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
mouse prion protein fragment 121-231 [SOLUTION NMR]
Mouse Prion Protein with mutation N174T [SOLUTION NMR]
mouse prion protein with mutations S170N and N174T [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation S170N [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutations Y225A and Y226A [SOLUTION NMR]
Mouse Prion Protein (121-231) with Mutation V166A [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutation D167S [SOLUTION NMR]
Mouse Prion Protein (121-231) with mutations D167S and N173K [SOLUTION NMR]
Mouse prion protein (121-231) containing the substitution Y169G [SOLUTION NMR]
>> 11 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000091288
AA Change: D201G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088833
Gene: ENSMUSG00000079037
AA Change: D201G

DomainStartEndE-ValueType
PRP 23 241 7.26e-181 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124100
SMART Domains Protein: ENSMUSP00000116195
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136783
SMART Domains Protein: ENSMUSP00000122345
Gene: ENSMUSG00000098754

DomainStartEndE-ValueType
Pfam:Doppel 1 30 2.5e-22 PFAM
Pfam:Prion 64 179 4.4e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mutations at this locus affect resistance to scrapie infection and spongiform encephalopathy and/or alter scrapie incubation time. Homozygous mutants also show impaired locomotor coordination and reduced mitochondria numbers with unusual morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Prnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prnp APN 2 131937111 missense probably benign
IGL01081:Prnp APN 2 131936420 intron probably benign
IGL01820:Prnp APN 2 131937070 missense probably benign 0.05
R0837:Prnp UTSW 2 131936524 missense probably damaging 1.00
R2303:Prnp UTSW 2 131937126 missense probably benign 0.00
R5214:Prnp UTSW 2 131937004 missense probably damaging 1.00
R6859:Prnp UTSW 2 131936788 missense possibly damaging 0.93
R7589:Prnp UTSW 2 131936866 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATCCATTTTGGCAACGACTGG -3'
(R):5'- CAGCCTAGACCACGAGAATG -3'

Sequencing Primer
(F):5'- ACTGGGAGGACCGCTACTAC -3'
(R):5'- CCTAGACCACGAGAATGCGAAG -3'
Posted On2016-10-24