Incidental Mutation 'R5562:Trim55'
ID436653
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Nametripartite motif-containing 55
SynonymsD830041C10Rik, Murf2
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19644474-19692421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19659153 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 123 (M123L)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
AA Change: M123L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: M123L

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19670952 missense probably damaging 1.00
IGL03095:Trim55 APN 3 19674465 missense probably benign 0.00
IGL03411:Trim55 APN 3 19659190 missense probably damaging 0.99
R0011:Trim55 UTSW 3 19670999 missense probably benign 0.00
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0194:Trim55 UTSW 3 19661861 missense probably benign 0.00
R0437:Trim55 UTSW 3 19670978 missense probably benign
R0450:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19644742 missense probably damaging 1.00
R1397:Trim55 UTSW 3 19644637 missense probably benign 0.01
R1928:Trim55 UTSW 3 19661882 critical splice donor site probably null
R2079:Trim55 UTSW 3 19644666 missense probably damaging 0.98
R3856:Trim55 UTSW 3 19672956 missense probably benign
R4646:Trim55 UTSW 3 19671122 missense probably benign 0.03
R4907:Trim55 UTSW 3 19674374 missense probably benign
R5090:Trim55 UTSW 3 19671607 missense probably benign 0.08
R6370:Trim55 UTSW 3 19691486 missense possibly damaging 0.87
R6658:Trim55 UTSW 3 19691555 missense probably damaging 1.00
R6786:Trim55 UTSW 3 19672774 missense probably benign
R8147:Trim55 UTSW 3 19672847 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCAAGCAGATGGAGATTTGTCAGC -3'
(R):5'- TGGTCACATGGAGCTAACTCAC -3'

Sequencing Primer
(F):5'- CAGATGGAGATTTGTCAGCACTTCTC -3'
(R):5'- GTCACATGGAGCTAACTCACTAGTG -3'
Posted On2016-10-24