Incidental Mutation 'R5562:Cyp2j8'
ID436655
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96470653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 343 (I343T)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably damaging
Transcript: ENSMUST00000124729
AA Change: I343T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: I343T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
R8878:Cyp2j8 UTSW 4 96470570 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGCATGGTTACCTTAGGCAG -3'
(R):5'- TGTTAGGATACAGAATAGCTTGACC -3'

Sequencing Primer
(F):5'- CTTAGGCAGGTGGAATCCG -3'
(R):5'- ACAGAATAGCTTGACCATATAGAGTC -3'
Posted On2016-10-24