Incidental Mutation 'R5562:Utp4'
ID436659
Institutional Source Beutler Lab
Gene Symbol Utp4
Ensembl Gene ENSMUSG00000041438
Gene NameUTP4 small subunit processome component
SynonymsTex292, TEG-292, Cirh1a
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106893636-106923088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106922925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 669 (D669N)
Ref Sequence ENSEMBL: ENSMUSP00000048377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047629]
Predicted Effect probably benign
Transcript: ENSMUST00000047629
AA Change: D669N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048377
Gene: ENSMUSG00000041438
AA Change: D669N

DomainStartEndE-ValueType
WD40 5 44 6.19e-1 SMART
WD40 48 87 1.48e1 SMART
WD40 90 129 5.39e-5 SMART
WD40 134 172 1.48e-2 SMART
WD40 185 222 7.96e0 SMART
WD40 225 264 3.55e1 SMART
WD40 276 313 7.96e0 SMART
Blast:WD40 378 417 2e-19 BLAST
WD40 426 465 8.25e0 SMART
WD40 470 512 3.99e-1 SMART
WD40 515 554 2.22e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212718
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40-repeat-containing protein that is localized to the nucleolus. Mutation of this gene causes North American Indian childhood cirrhosis, a severe intrahepatic cholestasis that results in transient neonatal jaundice, and progresses to periportal fibrosis and cirrhosis in childhood and adolescence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Utp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Utp4 APN 8 106894698 missense probably benign 0.02
IGL01871:Utp4 APN 8 106912317 missense probably benign
IGL02100:Utp4 APN 8 106898175 missense probably benign 0.00
IGL02501:Utp4 APN 8 106906241 missense probably benign 0.16
IGL02948:Utp4 APN 8 106894641 missense probably benign 0.31
IGL03210:Utp4 APN 8 106916256 missense probably benign
Cheyenne_canon UTSW 8 106912275 missense probably damaging 1.00
PIT4480001:Utp4 UTSW 8 106906185 missense probably benign 0.00
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0066:Utp4 UTSW 8 106922898 missense possibly damaging 0.70
R0145:Utp4 UTSW 8 106894669 missense probably benign 0.02
R0158:Utp4 UTSW 8 106913386 missense probably null
R0360:Utp4 UTSW 8 106898537 unclassified probably benign
R0364:Utp4 UTSW 8 106898537 unclassified probably benign
R0382:Utp4 UTSW 8 106922935 missense probably benign 0.01
R0798:Utp4 UTSW 8 106922226 missense probably benign 0.00
R1164:Utp4 UTSW 8 106900844 critical splice acceptor site probably null
R1381:Utp4 UTSW 8 106906276 missense probably benign 0.02
R1440:Utp4 UTSW 8 106898053 unclassified probably benign
R1711:Utp4 UTSW 8 106918720 missense probably damaging 1.00
R1839:Utp4 UTSW 8 106913454 missense probably benign
R1903:Utp4 UTSW 8 106912350 critical splice donor site probably null
R2060:Utp4 UTSW 8 106898521 missense probably benign 0.33
R2938:Utp4 UTSW 8 106922929 missense probably damaging 1.00
R5526:Utp4 UTSW 8 106917633 missense possibly damaging 0.70
R5764:Utp4 UTSW 8 106917616 missense possibly damaging 0.81
R5814:Utp4 UTSW 8 106912275 missense probably damaging 1.00
R6310:Utp4 UTSW 8 106918621 missense probably benign 0.16
R6478:Utp4 UTSW 8 106904446 critical splice donor site probably null
R6523:Utp4 UTSW 8 106898463 missense probably damaging 0.98
R7329:Utp4 UTSW 8 106913463 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCCAACTCCACTACAGG -3'
(R):5'- ATGACCTTCATGCCACTGC -3'

Sequencing Primer
(F):5'- AACTCCACTACAGGGCTGG -3'
(R):5'- AGGAAATCTGTGCTCATTCTTTTAG -3'
Posted On2016-10-24