Incidental Mutation 'R5562:Nudt7'
ID436660
Institutional Source Beutler Lab
Gene Symbol Nudt7
Ensembl Gene ENSMUSG00000031767
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 7
Synonyms2210404C19Rik, 1300007B24Rik
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location114133557-114154739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114147983 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 93 (A93D)
Ref Sequence ENSEMBL: ENSMUSP00000114598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066514] [ENSMUST00000073521] [ENSMUST00000109109] [ENSMUST00000134593] [ENSMUST00000147605]
Predicted Effect probably damaging
Transcript: ENSMUST00000066514
AA Change: A64D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065791
Gene: ENSMUSG00000031767
AA Change: A64D

DomainStartEndE-ValueType
Pfam:NUDIX 15 140 4.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073521
AA Change: A93D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073213
Gene: ENSMUSG00000031767
AA Change: A93D

DomainStartEndE-ValueType
Pfam:NUDIX 38 168 4.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109109
AA Change: A117D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104737
Gene: ENSMUSG00000031767
AA Change: A117D

DomainStartEndE-ValueType
Pfam:NUDIX 62 193 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134593
AA Change: A93D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116868
Gene: ENSMUSG00000031767
AA Change: A93D

DomainStartEndE-ValueType
Pfam:NUDIX 38 146 4.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147605
AA Change: A93D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114598
Gene: ENSMUSG00000031767
AA Change: A93D

DomainStartEndE-ValueType
Pfam:NUDIX 38 107 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Nudt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Nudt7 APN 8 114147885 splice site probably benign
IGL02549:Nudt7 APN 8 114151948 missense probably damaging 1.00
R0525:Nudt7 UTSW 8 114151652 critical splice acceptor site probably null
R0781:Nudt7 UTSW 8 114135371 intron probably benign
R5167:Nudt7 UTSW 8 114151827 nonsense probably null
R5198:Nudt7 UTSW 8 114135445 splice site probably null
R5597:Nudt7 UTSW 8 114151766 missense probably benign 0.12
R6957:Nudt7 UTSW 8 114133645 missense probably benign 0.03
R7410:Nudt7 UTSW 8 114133819 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGTAGATGCTGAGTCGATACTTG -3'
(R):5'- TGAAACTCACTGAGGTGGCTC -3'

Sequencing Primer
(F):5'- CGATACTTGTTGAGTGCCTAAATGC -3'
(R):5'- GAAGGGCCACAGAGCTCAC -3'
Posted On2016-10-24