Incidental Mutation 'R5562:Zfp560'
ID436663
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5562 (G1)
Quality Score191
Status Not validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20350587 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 89 (Y89*)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079] [ENSMUST00000143992]
Predicted Effect probably null
Transcript: ENSMUST00000068079
AA Change: Y89*
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: Y89*

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214965
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 unclassified probably null
R1569:Zfp560 UTSW 9 20348715 missense possibly damaging 0.83
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4182:Zfp560 UTSW 9 20347448 missense probably benign 0.11
R4509:Zfp560 UTSW 9 20348723 missense probably damaging 1.00
R4708:Zfp560 UTSW 9 20351918 missense possibly damaging 0.85
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R6863:Zfp560 UTSW 9 20348499 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
R7619:Zfp560 UTSW 9 20348910 missense probably benign 0.01
R7763:Zfp560 UTSW 9 20347323 missense possibly damaging 0.96
R8220:Zfp560 UTSW 9 20349052 missense probably benign 0.00
Z1176:Zfp560 UTSW 9 20347704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCAGCCTTCTGACTCAAG -3'
(R):5'- TATGAAGAAGTCAGTACCTACCAAC -3'

Sequencing Primer
(F):5'- CAGCCTTCTGACTCAAGTTTTC -3'
(R):5'- GTACCTACCAACACATATAAGGTCTG -3'
Posted On2016-10-24