Incidental Mutation 'R5562:Arih2'
ID436664
Institutional Source Beutler Lab
Gene Symbol Arih2
Ensembl Gene ENSMUSG00000064145
Gene Nameariadne RBR E3 ubiquitin protein ligase 2
SynonymsTRIAD1
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108602942-108649386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108607347 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 422 (T422A)
Ref Sequence ENSEMBL: ENSMUSP00000013338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013338] [ENSMUST00000193190] [ENSMUST00000193197] [ENSMUST00000193552]
Predicted Effect probably damaging
Transcript: ENSMUST00000013338
AA Change: T422A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000013338
Gene: ENSMUSG00000064145
AA Change: T422A

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 1.21e-1 SMART
IBR 207 269 7.29e-23 SMART
ZnF_C2HC 255 271 2.03e0 SMART
IBR 277 339 1.81e-9 SMART
RING 299 339 5.86e-1 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192853
Predicted Effect probably benign
Transcript: ENSMUST00000193190
SMART Domains Protein: ENSMUSP00000141914
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 5.7e-4 SMART
IBR 207 269 2.5e-25 SMART
ZnF_C2HC 255 271 8.4e-3 SMART
Blast:IBR 277 317 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193197
SMART Domains Protein: ENSMUSP00000141911
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
IBR 1 36 1.5e-3 SMART
ZnF_C2HC 22 38 8.4e-3 SMART
Blast:IBR 44 79 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193923
Predicted Effect probably benign
Transcript: ENSMUST00000194073
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene causes altered dendritic cell physiology, enhanced liver apoptosis, and complete fetal lethality that is partially modified by genetic background. On a mixed genetic background, mice that survive past weaning succumb to a severe multiorgan inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Arih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Arih2 APN 9 108605410 missense probably damaging 1.00
IGL03213:Arih2 APN 9 108607347 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0314:Arih2 UTSW 9 108608679 missense probably damaging 1.00
R0413:Arih2 UTSW 9 108616717 missense probably damaging 0.98
R0450:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0469:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0865:Arih2 UTSW 9 108649300 utr 5 prime probably benign
R2099:Arih2 UTSW 9 108616738 missense probably damaging 1.00
R2913:Arih2 UTSW 9 108644076 missense probably damaging 1.00
R4383:Arih2 UTSW 9 108644277 start codon destroyed probably benign 0.41
R4636:Arih2 UTSW 9 108613814 missense probably damaging 1.00
R5033:Arih2 UTSW 9 108611660 unclassified probably benign
R5976:Arih2 UTSW 9 108607973 makesense probably null
R6248:Arih2 UTSW 9 108611642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGAGCCAGCAATGGATTCTTG -3'
(R):5'- CTGAGGCGACTGGTGATAAATC -3'

Sequencing Primer
(F):5'- CCAGCAATGGATTCTTGTAGTAGGAC -3'
(R):5'- GCGACTGGTGATAAATCAGTATG -3'
Posted On2016-10-24