Mutagenetix > Incidental Mutations

Incidental Mutation 'R5562:Kif15'

436665

Institutional Source

Beutler Lab

Gene Symbol

Kif15

Ensembl Gene

ENSMUSG00000036768

Gene Name

kinesin family member 15

Synonyms

HKLP2, Knsl7, N-10 kinesin

MMRRC Submission

043119-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5562 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122951046-123018733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122978016 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 44 (Q44H)

Ref Sequence

ENSEMBL: ENSMUSP00000150678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000213745] [ENSMUST00000214652] [ENSMUST00000216388] [ENSMUST00000217401]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040717
AA Change: Q272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: Q272H

Domain	Start	End	E-Value	Type
KISc	24	371	2.86e-179	SMART
Pfam:Kinesin-relat_1	463	551	6.6e-26	PFAM
coiled coil region	579	643	N/A	INTRINSIC
coiled coil region	706	1037	N/A	INTRINSIC
coiled coil region	1065	1133	N/A	INTRINSIC
Pfam:HMMR_C	1265	1387	3.5e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213745
AA Change: Q272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214183

Predicted Effect

probably damaging
Transcript: ENSMUST00000214652
AA Change: Q44H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214880

Predicted Effect

probably damaging
Transcript: ENSMUST00000216388
AA Change: Q44H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000217401

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	C	A	16: 4,974,076		noncoding transcript	Het
Aldh1a7	G	A	19: 20,702,264	Q383*	probably null	Het
Alkbh3	A	T	2: 93,996,379		probably null	Het
Amotl1	G	A	9: 14,575,297	P434S	possibly damaging	Het
Arfgef1	T	C	1: 10,144,746	E1641G	probably damaging	Het
Arih2	T	C	9: 108,607,347	T422A	probably damaging	Het
C7	A	T	15: 5,031,915	Y317*	probably null	Het
Car4	A	T	11: 84,964,098	M91L	probably benign	Het
Ccdc7a	T	C	8: 129,058,785	D98G	possibly damaging	Het
Cdc25b	A	G	2: 131,194,758	M493V	probably damaging	Het
Cdhr3	C	G	12: 33,051,055	R452T	probably benign	Het
Col6a2	G	A	10: 76,599,675	Q909*	probably null	Het
Cyp2j8	A	G	4: 96,470,653	I343T	probably damaging	Het
Dcstamp	G	A	15: 39,754,402	C69Y	possibly damaging	Het
Efhc1	C	T	1: 20,972,880	T341I	probably damaging	Het
Elovl2	A	G	13: 41,185,296	*276Q	probably null	Het
Fnip1	T	A	11: 54,489,342		probably null	Het
Foxc1	A	G	13: 31,807,590	H128R	probably damaging	Het
Gm6768	T	A	12: 119,262,222		noncoding transcript	Het
Gpr107	C	T	2: 31,152,363	A2V	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Masp1	T	C	16: 23,465,167		probably null	Het
Muc5b	T	C	7: 141,847,238	I530T	unknown	Het
Nudt7	C	A	8: 114,147,983	A93D	probably damaging	Het
Olfr1133	T	C	2: 87,645,719	I135V	probably benign	Het
Pcdha8	A	G	18: 36,992,971	T169A	possibly damaging	Het
Prnp	A	G	2: 131,937,031	D201G	probably damaging	Het
Serinc1	G	A	10: 57,524,051	Q167*	probably null	Het
Slc13a5	A	G	11: 72,262,039	V35A	probably damaging	Het
Slc30a6	C	T	17: 74,412,705	T220I	possibly damaging	Het
Slc7a7	T	A	14: 54,408,812	M65L	probably benign	Het
Slc9a3r2	A	G	17: 24,641,824	V137A	probably benign	Het
Speg	T	A	1: 75,427,056	L2627Q	probably damaging	Het
Tank	A	G	2: 61,650,208	T363A	possibly damaging	Het
Taok3	T	A	5: 117,250,964	L478Q	probably damaging	Het
Trim55	A	T	3: 19,659,153	M123L	probably benign	Het
Trpm2	A	G	10: 77,959,939	V118A	possibly damaging	Het
Ttn	A	T	2: 76,770,459	Y17114N	probably damaging	Het
Unc5c	A	G	3: 141,768,530	T214A	probably damaging	Het
Ush2a	T	A	1: 188,576,217	V2021E	probably damaging	Het
Utp4	G	A	8: 106,922,925	D669N	probably benign	Het
Zfp560	G	T	9: 20,350,587	Y89*	probably null	Het
Zfp64	A	G	2: 168,925,722	S657P	probably benign	Het

Other mutations in Kif15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01459:Kif15	APN	9	122975755	missense	probably damaging	1.00
IGL01577:Kif15	APN	9	122996334	missense	probably benign	0.06
IGL01647:Kif15	APN	9	122963471	intron	probably benign
IGL01921:Kif15	APN	9	122979504	missense	probably damaging	1.00
IGL02040:Kif15	APN	9	123017385	missense	probably damaging	0.99
IGL02191:Kif15	APN	9	122975679	missense	probably damaging	1.00
IGL02218:Kif15	APN	9	122995827	splice site	probably benign
IGL02537:Kif15	APN	9	122993849	missense	probably benign	0.08
IGL02814:Kif15	APN	9	123003640	missense	possibly damaging	0.83
PIT4480001:Kif15	UTSW	9	123011543	missense	probably benign
R0034:Kif15	UTSW	9	122999285	missense	possibly damaging	0.47
R0458:Kif15	UTSW	9	123009359	missense	probably benign
R0526:Kif15	UTSW	9	122997797	missense	probably damaging	0.96
R0533:Kif15	UTSW	9	123009433	unclassified	probably benign
R0726:Kif15	UTSW	9	122959928	missense	probably benign	0.21
R1580:Kif15	UTSW	9	122959956	missense	probably benign	0.22
R1597:Kif15	UTSW	9	122994009	missense	probably benign	0.22
R2096:Kif15	UTSW	9	122986187	missense	probably damaging	1.00
R3125:Kif15	UTSW	9	122987961	missense	probably damaging	0.99
R3176:Kif15	UTSW	9	122987840	splice site	probably benign
R4088:Kif15	UTSW	9	122986189	missense	probably benign	0.29
R4308:Kif15	UTSW	9	123013982	missense	probably benign	0.00
R4597:Kif15	UTSW	9	122993849	missense	probably benign	0.08
R4705:Kif15	UTSW	9	122959993	splice site	probably null
R4832:Kif15	UTSW	9	123002126	splice site	probably null
R5100:Kif15	UTSW	9	122991994	missense	probably damaging	0.98
R5126:Kif15	UTSW	9	122975758	missense	probably damaging	1.00
R5180:Kif15	UTSW	9	122999210	missense	probably damaging	0.99
R5247:Kif15	UTSW	9	122986442	missense	possibly damaging	0.65
R5376:Kif15	UTSW	9	122993971	missense	probably benign	0.04
R5392:Kif15	UTSW	9	122996295	missense	probably damaging	0.99
R5422:Kif15	UTSW	9	122984889	splice site	probably null
R5663:Kif15	UTSW	9	122991851	splice site	probably null
R5767:Kif15	UTSW	9	123013974	missense	possibly damaging	0.78
R5927:Kif15	UTSW	9	123017261	missense	probably benign	0.00
R6049:Kif15	UTSW	9	123011622	missense	probably damaging	0.98
R6435:Kif15	UTSW	9	122986491	missense	probably damaging	1.00
R7040:Kif15	UTSW	9	123011614	missense	possibly damaging	0.67
R7158:Kif15	UTSW	9	122999314	missense	probably benign
R7163:Kif15	UTSW	9	123017657	missense	probably damaging	1.00
R7197:Kif15	UTSW	9	123009926	critical splice donor site	probably null
R7318:Kif15	UTSW	9	122987949	missense	probably damaging	1.00
R7360:Kif15	UTSW	9	122991137	missense	probably benign
R8039:Kif15	UTSW	9	123007425	missense	possibly damaging	0.82
R8228:Kif15	UTSW	9	122991976	missense	possibly damaging	0.82
R8549:Kif15	UTSW	9	122986171	missense	probably benign
Z1177:Kif15	UTSW	9	122951051	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGTCTTATCTAGAGGCTGGAG -3'
(R):5'- AAGTAGCCACTCTTGCTCCTG -3'

Sequencing Primer
(F):5'- GGAACAGACGTGTAGCATCAACATC -3'
(R):5'- TCTTGCTCCTGACAGGGATAGAC -3'

Posted On

2016-10-24