Incidental Mutation 'R5562:Serinc1'
ID436666
Institutional Source Beutler Lab
Gene Symbol Serinc1
Ensembl Gene ENSMUSG00000019877
Gene Nameserine incorporator 1
SynonymsTde2, TMS-2, Tde1l, 1500011D18Rik
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location57515774-57532530 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57524051 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 167 (Q167*)
Ref Sequence ENSEMBL: ENSMUSP00000020027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020027] [ENSMUST00000169122] [ENSMUST00000170062]
Predicted Effect probably null
Transcript: ENSMUST00000020027
AA Change: Q167*
SMART Domains Protein: ENSMUSP00000020027
Gene: ENSMUSG00000019877
AA Change: Q167*

DomainStartEndE-ValueType
Pfam:Serinc 16 451 9.5e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166997
Predicted Effect probably benign
Transcript: ENSMUST00000169122
SMART Domains Protein: ENSMUSP00000126561
Gene: ENSMUSG00000019877

DomainStartEndE-ValueType
Pfam:Serinc 15 152 1.9e-50 PFAM
Pfam:Serinc 149 220 6.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170062
SMART Domains Protein: ENSMUSP00000127041
Gene: ENSMUSG00000019877

DomainStartEndE-ValueType
Pfam:Serinc 15 113 9.1e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mutant mice exhibited signs of growth retardation including decreased mean body weight and length total tissue mass and lean body mass. No other notable phenotype was observed for the homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Serinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Serinc1 APN 10 57523108 missense probably damaging 1.00
IGL02600:Serinc1 APN 10 57523031 missense probably benign 0.23
IGL02666:Serinc1 APN 10 57523993 splice site probably null
IGL02829:Serinc1 APN 10 57523965 nonsense probably null
IGL03109:Serinc1 APN 10 57523069 missense probably benign 0.22
Olive UTSW 10 57517210 missense probably damaging 1.00
ANU74:Serinc1 UTSW 10 57519842 missense probably benign 0.00
R0254:Serinc1 UTSW 10 57523208 missense probably damaging 0.99
R0453:Serinc1 UTSW 10 57517210 missense probably damaging 1.00
R0845:Serinc1 UTSW 10 57525383 missense probably benign 0.39
R1912:Serinc1 UTSW 10 57525451 missense probably benign 0.05
R1913:Serinc1 UTSW 10 57519465 missense probably benign 0.01
R4820:Serinc1 UTSW 10 57525370 missense possibly damaging 0.89
R4947:Serinc1 UTSW 10 57523045 missense probably damaging 0.99
R5299:Serinc1 UTSW 10 57523051 missense probably damaging 0.99
R5589:Serinc1 UTSW 10 57523166 missense probably benign 0.01
R7182:Serinc1 UTSW 10 57524361 missense probably benign 0.00
R7723:Serinc1 UTSW 10 57527822 missense probably benign 0.08
Z1177:Serinc1 UTSW 10 57523010 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTCAGAGAACATCAG -3'
(R):5'- TAGTAACTGCTACCTGGAACTCC -3'

Sequencing Primer
(F):5'- GCCTCTTCAGAGAACATCAGAACAC -3'
(R):5'- GTAACTGCTACCTGGAACTCCTTTTC -3'
Posted On2016-10-24