Incidental Mutation 'R5562:Car4'
ID436671
Institutional Source Beutler Lab
Gene Symbol Car4
Ensembl Gene ENSMUSG00000000805
Gene Namecarbonic anhydrase 4
SynonymsCA IV
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5562 (G1)
Quality Score224
Status Not validated
Chromosome11
Chromosomal Location84957786-84966044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84964098 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 91 (M91L)
Ref Sequence ENSEMBL: ENSMUSP00000099483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103194] [ENSMUST00000127827] [ENSMUST00000150596]
PDB Structure
MURINE CARBONIC ANHYDRASE IV [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE IV COMPLEXED WITH BRINZOLAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000103194
AA Change: M91L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099483
Gene: ENSMUSG00000000805
AA Change: M91L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Carb_anhydrase 22 278 2.37e-103 SMART
low complexity region 283 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108076
SMART Domains Protein: ENSMUSP00000103711
Gene: ENSMUSG00000000805

DomainStartEndE-ValueType
Carb_anhydrase 3 137 9.49e-7 SMART
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139416
Predicted Effect probably benign
Transcript: ENSMUST00000150596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are produced in lower than expected numbers, with females preferentially lost in the fetal or early postnatal period. Surviving homozygotes are healthy and fertile when crossed with wild-type partners; however, homozygous intercrosses yield small litters and pups do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Car4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Car4 APN 11 84965767 missense probably damaging 1.00
IGL01121:Car4 APN 11 84964346 critical splice acceptor site probably null
IGL01828:Car4 APN 11 84964745 missense probably benign 0.19
IGL02340:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02351:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02353:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02358:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02360:Car4 APN 11 84965767 missense probably damaging 1.00
PIT4802001:Car4 UTSW 11 84964405 missense probably damaging 1.00
R0008:Car4 UTSW 11 84963411 unclassified probably benign
R0501:Car4 UTSW 11 84963442 missense probably benign 0.01
R2124:Car4 UTSW 11 84964085 splice site probably benign
R3907:Car4 UTSW 11 84964357 missense probably damaging 1.00
R5072:Car4 UTSW 11 84963367 missense probably benign
R5268:Car4 UTSW 11 84965800 missense probably benign 0.28
R6508:Car4 UTSW 11 84965643 missense possibly damaging 0.64
R7775:Car4 UTSW 11 84965623 missense probably damaging 1.00
Z1177:Car4 UTSW 11 84963419 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGGCTACATTTTGGGATAGG -3'
(R):5'- TGGGTACACACCTGGAATCC -3'

Sequencing Primer
(F):5'- ACATTTTGGGATAGGTATATGAGAGG -3'
(R):5'- TGGAATCCAGCCCAGGAC -3'
Posted On2016-10-24