Incidental Mutation 'R5562:Elovl2'
ID436676
Institutional Source Beutler Lab
Gene Symbol Elovl2
Ensembl Gene ENSMUSG00000021364
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
SynonymsSsc2
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location41182381-41220405 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 41185296 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 276 (*276Q)
Ref Sequence ENSEMBL: ENSMUSP00000114112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021793] [ENSMUST00000117096]
Predicted Effect probably null
Transcript: ENSMUST00000021793
AA Change: *293Q
SMART Domains Protein: ENSMUSP00000021793
Gene: ENSMUSG00000021364
AA Change: *293Q

DomainStartEndE-ValueType
Pfam:ELO 30 265 1.4e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117096
AA Change: *276Q
SMART Domains Protein: ENSMUSP00000114112
Gene: ENSMUSG00000021364
AA Change: *276Q

DomainStartEndE-ValueType
Pfam:ELO 13 248 5.8e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced male fertility. Mice homozygous for a knock-out allele exhibit male infertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Elovl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Elovl2 APN 13 41185314 missense probably benign 0.01
IGL01769:Elovl2 APN 13 41186944 missense probably damaging 1.00
IGL02514:Elovl2 APN 13 41194771 missense probably benign 0.00
R0542:Elovl2 UTSW 13 41191976 splice site probably benign
R0765:Elovl2 UTSW 13 41187466 missense probably benign 0.17
R1076:Elovl2 UTSW 13 41190107 missense possibly damaging 0.83
R7860:Elovl2 UTSW 13 41187467 missense probably benign 0.04
R7943:Elovl2 UTSW 13 41187467 missense probably benign 0.04
R8299:Elovl2 UTSW 13 41191920 missense probably benign 0.00
Z1177:Elovl2 UTSW 13 41189978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTTTGTAGAGGTCGGC -3'
(R):5'- GCTATGTCGGGAGTTAGAGAC -3'

Sequencing Primer
(F):5'- CATGGCTCCAGTTAGTAGAGTAACC -3'
(R):5'- GAGACAAGGCCTTATTAAAATGCC -3'
Posted On2016-10-24