Incidental Mutation 'R5562:Slc7a7'
ID436677
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonymsmy+lat1
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54369442-54417780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54408812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 65 (M65L)
Ref Sequence ENSEMBL: ENSMUSP00000154352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000195970] [ENSMUST00000195999] [ENSMUST00000196215] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000227334] [ENSMUST00000227967] [ENSMUST00000228488]
Predicted Effect probably benign
Transcript: ENSMUST00000000984
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: M65L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195970
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: M65L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195999
Predicted Effect probably benign
Transcript: ENSMUST00000196215
SMART Domains Protein: ENSMUSP00000142710
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197440
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: M65L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200545
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958
AA Change: M65L

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226753
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227334
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227967
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228488
AA Change: M65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54377924 unclassified probably benign
R0608:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R1311:Slc7a7 UTSW 14 54373030 nonsense probably null
R1489:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R1490:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54373091 critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R5745:Slc7a7 UTSW 14 54377835 missense possibly damaging 0.46
R5907:Slc7a7 UTSW 14 54379103 missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54379058 missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54374600 missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54377761 splice site probably null
R6776:Slc7a7 UTSW 14 54374651 missense possibly damaging 0.95
R7310:Slc7a7 UTSW 14 54379025 missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54374268 missense possibly damaging 0.87
R7903:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
R7986:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGATGAACGCAAGGAATCC -3'
(R):5'- TTCCTTAGAGGGCAATGCGAG -3'

Sequencing Primer
(F):5'- GCAAGGAATCCCCCGAAG -3'
(R):5'- CACCAAGTATGAAGTGGCTGCTC -3'
Posted On2016-10-24