Incidental Mutation 'R5562:Masp1'
ID 436681
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission 043119-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R5562 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation splice site (3196 bp from exon)
DNA Base Change (assembly) T to C at 23283917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000089883] [ENSMUST00000229619]
AlphaFold P98064
Predicted Effect probably null
Transcript: ENSMUST00000089883
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089883
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229619
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 G A 19: 20,679,628 (GRCm39) Q383* probably null Het
Alkbh3 A T 2: 93,826,724 (GRCm39) probably null Het
Amotl1 G A 9: 14,486,593 (GRCm39) P434S possibly damaging Het
Arfgef1 T C 1: 10,214,971 (GRCm39) E1641G probably damaging Het
Arih2 T C 9: 108,484,546 (GRCm39) T422A probably damaging Het
C7 A T 15: 5,061,397 (GRCm39) Y317* probably null Het
Car4 A T 11: 84,854,924 (GRCm39) M91L probably benign Het
Ccdc7a T C 8: 129,785,266 (GRCm39) D98G possibly damaging Het
Cdc25b A G 2: 131,036,678 (GRCm39) M493V probably damaging Het
Cdhr3 C G 12: 33,101,054 (GRCm39) R452T probably benign Het
Col6a2 G A 10: 76,435,509 (GRCm39) Q909* probably null Het
Cyp2j8 A G 4: 96,358,890 (GRCm39) I343T probably damaging Het
Dcstamp G A 15: 39,617,798 (GRCm39) C69Y possibly damaging Het
Dnaaf8 C A 16: 4,791,940 (GRCm39) noncoding transcript Het
Efhc1 C T 1: 21,043,104 (GRCm39) T341I probably damaging Het
Elovl2 A G 13: 41,338,772 (GRCm39) *276Q probably null Het
Fnip1 T A 11: 54,380,168 (GRCm39) probably null Het
Foxc1 A G 13: 31,991,573 (GRCm39) H128R probably damaging Het
Gpr107 C T 2: 31,042,375 (GRCm39) A2V probably damaging Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Kif15 A T 9: 122,807,081 (GRCm39) Q44H probably damaging Het
Muc5b T C 7: 141,400,975 (GRCm39) I530T unknown Het
Ncoa4-ps T A 12: 119,225,957 (GRCm39) noncoding transcript Het
Nherf2 A G 17: 24,860,798 (GRCm39) V137A probably benign Het
Nudt7 C A 8: 114,874,723 (GRCm39) A93D probably damaging Het
Or5w1b T C 2: 87,476,063 (GRCm39) I135V probably benign Het
Pcdha8 A G 18: 37,126,024 (GRCm39) T169A possibly damaging Het
Prnp A G 2: 131,778,951 (GRCm39) D201G probably damaging Het
Serinc1 G A 10: 57,400,147 (GRCm39) Q167* probably null Het
Slc13a5 A G 11: 72,152,865 (GRCm39) V35A probably damaging Het
Slc30a6 C T 17: 74,719,700 (GRCm39) T220I possibly damaging Het
Slc7a7 T A 14: 54,646,269 (GRCm39) M65L probably benign Het
Speg T A 1: 75,403,700 (GRCm39) L2627Q probably damaging Het
Tank A G 2: 61,480,552 (GRCm39) T363A possibly damaging Het
Taok3 T A 5: 117,389,029 (GRCm39) L478Q probably damaging Het
Trim55 A T 3: 19,713,317 (GRCm39) M123L probably benign Het
Trpm2 A G 10: 77,795,773 (GRCm39) V118A possibly damaging Het
Ttn A T 2: 76,600,803 (GRCm39) Y17114N probably damaging Het
Unc5c A G 3: 141,474,291 (GRCm39) T214A probably damaging Het
Ush2a T A 1: 188,308,414 (GRCm39) V2021E probably damaging Het
Utp4 G A 8: 107,649,557 (GRCm39) D669N probably benign Het
Zfp560 G T 9: 20,261,883 (GRCm39) Y89* probably null Het
Zfp64 A G 2: 168,767,642 (GRCm39) S657P probably benign Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23,273,675 (GRCm39) missense probably benign 0.01
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7069:Masp1 UTSW 16 23,271,205 (GRCm39) missense probably benign 0.20
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23,295,068 (GRCm39) missense probably benign 0.01
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9599:Masp1 UTSW 16 23,271,698 (GRCm39) missense probably benign 0.16
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGGTCCTTAGCTTTCACC -3'
(R):5'- GGGGATCTACAGGTTTACATAACTG -3'

Sequencing Primer
(F):5'- AGCTTTCACCCTGTTCCCAG -3'
(R):5'- AGAACTCAGCACTGGGAT -3'
Posted On 2016-10-24