Mutagenetix > Incidental Mutation

Incidental Mutation 'R5562:Masp1'

436681

Institutional Source

Beutler Lab

Gene Symbol

Masp1

Ensembl Gene

ENSMUSG00000022887

Gene Name

mannan-binding lectin serine peptidase 1

Synonyms

Crarf

MMRRC Submission

043119-MU

Accession Numbers

Genbank: NM_008555; MGI: 88492

Essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R5562 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23449417-23520815 bp(-) (GRCm38)

Type of Mutation

splice site (3196 bp from exon)

DNA Base Change (assembly)

T to C at 23465167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000089883] [ENSMUST00000229619]

AlphaFold

P98064

Predicted Effect

probably null
Transcript: ENSMUST00000089883

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089883

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000229619

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	C	A	16: 4,974,076		noncoding transcript	Het
Aldh1a7	G	A	19: 20,702,264	Q383*	probably null	Het
Alkbh3	A	T	2: 93,996,379		probably null	Het
Amotl1	G	A	9: 14,575,297	P434S	possibly damaging	Het
Arfgef1	T	C	1: 10,144,746	E1641G	probably damaging	Het
Arih2	T	C	9: 108,607,347	T422A	probably damaging	Het
C7	A	T	15: 5,031,915	Y317*	probably null	Het
Car4	A	T	11: 84,964,098	M91L	probably benign	Het
Ccdc7a	T	C	8: 129,058,785	D98G	possibly damaging	Het
Cdc25b	A	G	2: 131,194,758	M493V	probably damaging	Het
Cdhr3	C	G	12: 33,051,055	R452T	probably benign	Het
Col6a2	G	A	10: 76,599,675	Q909*	probably null	Het
Cyp2j8	A	G	4: 96,470,653	I343T	probably damaging	Het
Dcstamp	G	A	15: 39,754,402	C69Y	possibly damaging	Het
Efhc1	C	T	1: 20,972,880	T341I	probably damaging	Het
Elovl2	A	G	13: 41,185,296	*276Q	probably null	Het
Fnip1	T	A	11: 54,489,342		probably null	Het
Foxc1	A	G	13: 31,807,590	H128R	probably damaging	Het
Gm6768	T	A	12: 119,262,222		noncoding transcript	Het
Gpr107	C	T	2: 31,152,363	A2V	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Kif15	A	T	9: 122,978,016	Q44H	probably damaging	Het
Muc5b	T	C	7: 141,847,238	I530T	unknown	Het
Nudt7	C	A	8: 114,147,983	A93D	probably damaging	Het
Olfr1133	T	C	2: 87,645,719	I135V	probably benign	Het
Pcdha8	A	G	18: 36,992,971	T169A	possibly damaging	Het
Prnp	A	G	2: 131,937,031	D201G	probably damaging	Het
Serinc1	G	A	10: 57,524,051	Q167*	probably null	Het
Slc13a5	A	G	11: 72,262,039	V35A	probably damaging	Het
Slc30a6	C	T	17: 74,412,705	T220I	possibly damaging	Het
Slc7a7	T	A	14: 54,408,812	M65L	probably benign	Het
Slc9a3r2	A	G	17: 24,641,824	V137A	probably benign	Het
Speg	T	A	1: 75,427,056	L2627Q	probably damaging	Het
Tank	A	G	2: 61,650,208	T363A	possibly damaging	Het
Taok3	T	A	5: 117,250,964	L478Q	probably damaging	Het
Trim55	A	T	3: 19,659,153	M123L	probably benign	Het
Trpm2	A	G	10: 77,959,939	V118A	possibly damaging	Het
Ttn	A	T	2: 76,770,459	Y17114N	probably damaging	Het
Unc5c	A	G	3: 141,768,530	T214A	probably damaging	Het
Ush2a	T	A	1: 188,576,217	V2021E	probably damaging	Het
Utp4	G	A	8: 106,922,925	D669N	probably benign	Het
Zfp560	G	T	9: 20,350,587	Y89*	probably null	Het
Zfp64	A	G	2: 168,925,722	S657P	probably benign	Het

Other mutations in Masp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Masp1	APN	16	23458091	missense	possibly damaging	0.93
IGL00428:Masp1	APN	16	23476312	missense	probably damaging	1.00
IGL00432:Masp1	APN	16	23513851	missense	probably damaging	1.00
IGL02598:Masp1	APN	16	23459631	missense	probably benign
IGL02718:Masp1	APN	16	23476293	missense	probably damaging	1.00
IGL02947:Masp1	APN	16	23494726	missense	probably damaging	0.99
A4554:Masp1	UTSW	16	23454940	splice site	probably null
PIT1430001:Masp1	UTSW	16	23513944	missense	probably damaging	1.00
R0103:Masp1	UTSW	16	23458018	missense	probably damaging	1.00
R0505:Masp1	UTSW	16	23458138	missense	probably benign
R0630:Masp1	UTSW	16	23452419	missense	probably benign	0.01
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1339:Masp1	UTSW	16	23452467	missense	probably damaging	1.00
R1521:Masp1	UTSW	16	23494637	missense	probably damaging	1.00
R1588:Masp1	UTSW	16	23494654	missense	probably damaging	1.00
R1961:Masp1	UTSW	16	23452932	missense	probably damaging	1.00
R1986:Masp1	UTSW	16	23483461	missense	probably benign	0.01
R2080:Masp1	UTSW	16	23491959	missense	probably damaging	1.00
R2215:Masp1	UTSW	16	23452521	missense	possibly damaging	0.92
R2216:Masp1	UTSW	16	23492055	missense	probably benign	0.00
R2443:Masp1	UTSW	16	23476312	missense	probably damaging	1.00
R4934:Masp1	UTSW	16	23465076	missense	probably damaging	0.98
R5224:Masp1	UTSW	16	23494695	missense	probably damaging	1.00
R5340:Masp1	UTSW	16	23458108	missense	probably damaging	1.00
R5663:Masp1	UTSW	16	23452938	missense	possibly damaging	0.57
R5742:Masp1	UTSW	16	23454925	missense	probably benign	0.01
R5763:Masp1	UTSW	16	23496247	missense	probably damaging	1.00
R5898:Masp1	UTSW	16	23491927	missense	probably damaging	0.99
R6901:Masp1	UTSW	16	23513834	missense	probably damaging	0.99
R6987:Masp1	UTSW	16	23513915	missense	probably damaging	1.00
R7069:Masp1	UTSW	16	23452455	missense	probably benign	0.20
R7356:Masp1	UTSW	16	23470243	missense	possibly damaging	0.50
R7512:Masp1	UTSW	16	23470124	missense	probably damaging	1.00
R7539:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R7810:Masp1	UTSW	16	23476318	missense	probably benign	0.01
R8026:Masp1	UTSW	16	23484406	missense	probably damaging	1.00
R8391:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R8438:Masp1	UTSW	16	23470403	missense	probably benign	0.38
R8475:Masp1	UTSW	16	23452531	missense	probably damaging	0.99
R8870:Masp1	UTSW	16	23496132	missense	probably damaging	1.00
R9052:Masp1	UTSW	16	23520600	start gained	probably benign
R9072:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9073:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9599:Masp1	UTSW	16	23452948	missense	probably benign	0.16
R9686:Masp1	UTSW	16	23496137	missense	probably damaging	1.00
X0065:Masp1	UTSW	16	23513969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTGGTCCTTAGCTTTCACC -3'
(R):5'- GGGGATCTACAGGTTTACATAACTG -3'

Sequencing Primer
(F):5'- AGCTTTCACCCTGTTCCCAG -3'
(R):5'- AGAACTCAGCACTGGGAT -3'

Posted On

2016-10-24