Incidental Mutation 'R5562:Slc9a3r2'
ID436682
Institutional Source Beutler Lab
Gene Symbol Slc9a3r2
Ensembl Gene ENSMUSG00000002504
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2
SynonymsSip1, 0610011L07Rik, Sryip1, Nherf2, Octs2, Tka-1, Sip-1, E3karp, 2010007A20Rik, 1200011K07Rik
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24639282-24650305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24641824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000019684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572] [ENSMUST00000019684] [ENSMUST00000047611]
Predicted Effect probably benign
Transcript: ENSMUST00000002572
AA Change: V248A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504
AA Change: V248A

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019684
AA Change: V137A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000019684
Gene: ENSMUSG00000002504
AA Change: V137A

DomainStartEndE-ValueType
PDZ 48 120 8.79e-20 SMART
Pfam:EBP50_C-term 186 226 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047611
SMART Domains Protein: ENSMUSP00000047413
Gene: ENSMUSG00000041429

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 24 37 N/A INTRINSIC
low complexity region 55 68 N/A INTRINSIC
ENDO3c 126 276 1.06e-58 SMART
FES 277 297 4.82e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal and display normal cAMP- and cGMP-activated CFTR transepithelial chloride transport and bicarbonate secretion in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Slc9a3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Slc9a3r2 APN 17 24641956 missense probably damaging 1.00
R1843:Slc9a3r2 UTSW 17 24641719 missense possibly damaging 0.75
R2199:Slc9a3r2 UTSW 17 24640596 missense probably null 0.37
R2912:Slc9a3r2 UTSW 17 24642241 missense probably damaging 1.00
R4774:Slc9a3r2 UTSW 17 24644899 start codon destroyed probably null 0.01
R5352:Slc9a3r2 UTSW 17 24642255 missense probably damaging 1.00
R5356:Slc9a3r2 UTSW 17 24641971 missense probably damaging 1.00
R5841:Slc9a3r2 UTSW 17 24644877 missense probably benign
R7231:Slc9a3r2 UTSW 17 24650104 missense probably damaging 1.00
R7338:Slc9a3r2 UTSW 17 24650208 start gained probably benign
R7539:Slc9a3r2 UTSW 17 24641899 missense probably damaging 0.99
R8276:Slc9a3r2 UTSW 17 24642260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCTTCTATCATGTCTGG -3'
(R):5'- TAGGCCTTTCTGACCCTGTGTG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TGTGTGGGTGGCGGCAG -3'
Posted On2016-10-24