Incidental Mutation 'R5562:Slc30a6'
ID436683
Institutional Source Beutler Lab
Gene Symbol Slc30a6
Ensembl Gene ENSMUSG00000024069
Gene Namesolute carrier family 30 (zinc transporter), member 6
SynonymsZnT6, ZnT-6
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R5562 (G1)
Quality Score176
Status Not validated
Chromosome17
Chromosomal Location74395608-74424229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74412705 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 220 (T220I)
Ref Sequence ENSEMBL: ENSMUSP00000136503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024870] [ENSMUST00000179074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024870
AA Change: T215I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024870
Gene: ENSMUSG00000024069
AA Change: T215I

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 336 6.9e-45 PFAM
low complexity region 371 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179074
AA Change: T220I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136503
Gene: ENSMUSG00000024069
AA Change: T220I

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 260 5.7e-30 PFAM
low complexity region 376 397 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function as zinc transporters. This protein can regulate subcellular levels of zinc in the Golgi and vesicles. Expression of this gene is altered in the Alzheimer's disease brain plaques. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Slc30a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Slc30a6 APN 17 74408839 splice site probably benign
IGL01592:Slc30a6 APN 17 74419528 splice site probably benign
IGL02556:Slc30a6 APN 17 74404059 missense probably damaging 1.00
IGL03033:Slc30a6 APN 17 74409378 nonsense probably null
IGL03149:Slc30a6 APN 17 74423023 missense probably damaging 1.00
R0355:Slc30a6 UTSW 17 74423203 missense probably benign
R0791:Slc30a6 UTSW 17 74415645 missense possibly damaging 0.89
R0792:Slc30a6 UTSW 17 74415645 missense possibly damaging 0.89
R1507:Slc30a6 UTSW 17 74408862 missense probably damaging 1.00
R1517:Slc30a6 UTSW 17 74408847 missense probably benign 0.25
R1585:Slc30a6 UTSW 17 74418615 splice site probably benign
R1944:Slc30a6 UTSW 17 74408863 missense probably damaging 0.99
R2925:Slc30a6 UTSW 17 74402004 splice site probably benign
R3891:Slc30a6 UTSW 17 74419546 missense probably benign 0.19
R4840:Slc30a6 UTSW 17 74405721 missense probably damaging 1.00
R4863:Slc30a6 UTSW 17 74412654 missense possibly damaging 0.84
R5330:Slc30a6 UTSW 17 74423195 missense probably benign 0.24
R5331:Slc30a6 UTSW 17 74423195 missense probably benign 0.24
R6458:Slc30a6 UTSW 17 74423113 missense probably damaging 1.00
R6681:Slc30a6 UTSW 17 74404032 missense possibly damaging 0.53
R7419:Slc30a6 UTSW 17 74423429 missense probably benign
R7457:Slc30a6 UTSW 17 74407238 missense probably benign 0.05
R7596:Slc30a6 UTSW 17 74415669 missense probably benign 0.00
R7844:Slc30a6 UTSW 17 74404093 splice site probably null
R7927:Slc30a6 UTSW 17 74404093 splice site probably null
R8043:Slc30a6 UTSW 17 74423023 missense probably damaging 0.99
R8097:Slc30a6 UTSW 17 74412698 missense possibly damaging 0.92
T0722:Slc30a6 UTSW 17 74412324 critical splice donor site probably null
X0003:Slc30a6 UTSW 17 74412324 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCTGCACAGTGGCCAAGC -3'
(R):5'- GTTGAGGCTAAGACCTGACCTG -3'

Sequencing Primer
(F):5'- ACAGTGGCCAAGCTTTGTC -3'
(R):5'- GCTAAGACCTGACCTGGTTATATGAG -3'
Posted On2016-10-24