Incidental Mutation 'R5562:Aldh1a7'
ID436687
Institutional Source Beutler Lab
Gene Symbol Aldh1a7
Ensembl Gene ENSMUSG00000024747
Gene Namealdehyde dehydrogenase family 1, subfamily A7
SynonymsAldh-pb, Ahd2-like
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5562 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20692953-20727562 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 20702264 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 383 (Q383*)
Ref Sequence ENSEMBL: ENSMUSP00000025656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025656]
Predicted Effect probably null
Transcript: ENSMUST00000025656
AA Change: Q383*
SMART Domains Protein: ENSMUSP00000025656
Gene: ENSMUSG00000024747
AA Change: Q383*

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 2.5e-185 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik C A 16: 4,974,076 noncoding transcript Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in Aldh1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Aldh1a7 APN 19 20700046 missense probably damaging 1.00
IGL01132:Aldh1a7 APN 19 20727040 missense possibly damaging 0.76
IGL01630:Aldh1a7 APN 19 20696329 splice site probably benign
IGL01901:Aldh1a7 APN 19 20717739 missense probably damaging 0.99
IGL02324:Aldh1a7 APN 19 20727004 missense probably damaging 1.00
IGL02822:Aldh1a7 APN 19 20702266 missense possibly damaging 0.85
IGL03162:Aldh1a7 APN 19 20708281 missense probably benign 0.21
PIT4514001:Aldh1a7 UTSW 19 20702240 missense probably benign 0.07
R0125:Aldh1a7 UTSW 19 20727066 splice site probably benign
R0268:Aldh1a7 UTSW 19 20709502 critical splice acceptor site probably null
R0833:Aldh1a7 UTSW 19 20702243 missense probably damaging 1.00
R1665:Aldh1a7 UTSW 19 20727461 missense probably benign
R1709:Aldh1a7 UTSW 19 20715952 missense probably damaging 1.00
R1772:Aldh1a7 UTSW 19 20716019 missense probably damaging 1.00
R1917:Aldh1a7 UTSW 19 20727455 missense probably benign
R2570:Aldh1a7 UTSW 19 20699956 missense probably benign 0.35
R3778:Aldh1a7 UTSW 19 20719311 missense possibly damaging 0.70
R3832:Aldh1a7 UTSW 19 20708238 missense probably damaging 1.00
R3894:Aldh1a7 UTSW 19 20696398 nonsense probably null
R4601:Aldh1a7 UTSW 19 20715979 missense probably damaging 0.98
R4948:Aldh1a7 UTSW 19 20727010 missense possibly damaging 0.77
R5606:Aldh1a7 UTSW 19 20722367 missense probably damaging 1.00
R5641:Aldh1a7 UTSW 19 20715929 missense probably benign 0.00
R5808:Aldh1a7 UTSW 19 20708197 missense possibly damaging 0.79
R6646:Aldh1a7 UTSW 19 20699911 missense possibly damaging 0.94
R6759:Aldh1a7 UTSW 19 20699956 missense possibly damaging 0.89
R7034:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7036:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7150:Aldh1a7 UTSW 19 20716018 missense probably damaging 1.00
R7255:Aldh1a7 UTSW 19 20714728 missense probably damaging 1.00
R7875:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
R7958:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
X0022:Aldh1a7 UTSW 19 20719315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATTCCTCAGTGCTCAGTCG -3'
(R):5'- TCACCTGCTTTGAATGACCAG -3'

Sequencing Primer
(F):5'- AGTGCTCAGTCGTGCTCAC -3'
(R):5'- GAATATCCTGGCATTTTTGACGC -3'
Posted On2016-10-24