Incidental Mutation 'R0006:Rbfox1'
ID43670
Institutional Source Beutler Lab
Gene Symbol Rbfox1
Ensembl Gene ENSMUSG00000008658
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 1
SynonymsFOX1, A2bp, A2bp1, HRNBP1
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0006 (G1)
Quality Score180
Status Validated
Chromosome16
Chromosomal Location5885355-7411526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7330420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 244 (S244R)
Ref Sequence ENSEMBL: ENSMUSP00000155069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056416] [ENSMUST00000115841] [ENSMUST00000229741] [ENSMUST00000230658] [ENSMUST00000231088] [ENSMUST00000231194]
Predicted Effect probably benign
Transcript: ENSMUST00000056416
AA Change: S244R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049970
Gene: ENSMUSG00000008658
AA Change: S244R

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
RRM 137 208 1.77e-24 SMART
Pfam:Fox-1_C 272 362 1.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115841
AA Change: S244R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111507
Gene: ENSMUSG00000008658
AA Change: S244R

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RRM 117 188 1.77e-24 SMART
Pfam:Fox-1_C 252 341 2.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229741
AA Change: S264R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000230658
AA Change: S244R

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000231088
AA Change: S206R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231194
AA Change: S244R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit reduced fertility, infrequent spontaneous seizures, increased susceptibility to kainic acid-induced seizures and lethality, and increased neuronal excitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Rbfox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Rbfox1 APN 16 7369834 missense probably benign 0.02
IGL01070:Rbfox1 APN 16 7306443 missense possibly damaging 0.78
IGL02633:Rbfox1 APN 16 7292214 missense probably damaging 0.99
IGL03037:Rbfox1 APN 16 7292283 splice site probably benign
R0647:Rbfox1 UTSW 16 7224384 missense probably damaging 1.00
R1439:Rbfox1 UTSW 16 7330433 missense possibly damaging 0.51
R1656:Rbfox1 UTSW 16 7306469 splice site probably benign
R1677:Rbfox1 UTSW 16 7292227 missense possibly damaging 0.92
R2155:Rbfox1 UTSW 16 7294082 missense possibly damaging 0.91
R3236:Rbfox1 UTSW 16 7408028 missense possibly damaging 0.94
R4952:Rbfox1 UTSW 16 7277088 missense probably benign 0.00
R4971:Rbfox1 UTSW 16 7294088 missense probably damaging 1.00
R5115:Rbfox1 UTSW 16 7409772 missense probably damaging 1.00
R5784:Rbfox1 UTSW 16 7224339 missense probably damaging 0.96
R6380:Rbfox1 UTSW 16 7224350 nonsense probably null
R7102:Rbfox1 UTSW 16 7369834 missense probably benign 0.02
R7104:Rbfox1 UTSW 16 7353003 missense possibly damaging 0.90
R7218:Rbfox1 UTSW 16 7294083 missense probably damaging 1.00
R7348:Rbfox1 UTSW 16 7408024 nonsense probably null
R7383:Rbfox1 UTSW 16 7070035 missense probably benign 0.17
R7903:Rbfox1 UTSW 16 7224511 missense probably benign 0.20
R7986:Rbfox1 UTSW 16 7224511 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGACCCCTTTTGAGAATGCCACAC -3'
(R):5'- TGCATACCTGGGAGGCAGAATCAC -3'

Sequencing Primer
(F):5'- GCAGGCTGTTACTAACTAGACC -3'
(R):5'- ATCACTATGAATGTGAGCAAGC -3'
Posted On2013-05-29