Incidental Mutation 'R5563:Vmn2r68'
ID436702
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 043120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5563 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85222075 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 667 (T667A)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably damaging
Transcript: ENSMUST00000061074
AA Change: T667A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: T667A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Ighv3-1 T A 12: 113,964,586 Y51F probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mfsd4b2 C T 10: 39,922,042 E106K probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Parp6 G A 9: 59,628,673 probably null Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Prtg G A 9: 72,856,898 R551H probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Uba5 G T 9: 104,049,247 T372K probably benign Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAACAATGATGATGTGGCCATG -3'
(R):5'- GCATCTTCCTGAAACACCGAG -3'

Sequencing Primer
(F):5'- GCCATGTACCATGTGTGCATCAG -3'
(R):5'- TCTTCCTGAAACACCGAGAAACTC -3'
Posted On2016-10-24