Incidental Mutation 'R5563:Parp6'
ID436706
Institutional Source Beutler Lab
Gene Symbol Parp6
Ensembl Gene ENSMUSG00000025237
Gene Namepoly (ADP-ribose) polymerase family, member 6
Synonyms
MMRRC Submission 043120-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R5563 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59617284-59650285 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 59628673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026267] [ENSMUST00000026267] [ENSMUST00000050483] [ENSMUST00000167091] [ENSMUST00000216351]
Predicted Effect probably null
Transcript: ENSMUST00000026267
SMART Domains Protein: ENSMUSP00000026267
Gene: ENSMUSG00000025237

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Pfam:PARP 450 580 5.6e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026267
SMART Domains Protein: ENSMUSP00000026267
Gene: ENSMUSG00000025237

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Pfam:PARP 450 580 5.6e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050483
SMART Domains Protein: ENSMUSP00000063065
Gene: ENSMUSG00000025237

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 303 315 N/A INTRINSIC
SCOP:d1a26_2 409 475 4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167091
SMART Domains Protein: ENSMUSP00000129456
Gene: ENSMUSG00000025237

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
SCOP:d1a26_2 429 473 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215381
Predicted Effect probably benign
Transcript: ENSMUST00000216351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217195
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Ighv3-1 T A 12: 113,964,586 Y51F probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mfsd4b2 C T 10: 39,922,042 E106K probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Prtg G A 9: 72,856,898 R551H probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Uba5 G T 9: 104,049,247 T372K probably benign Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Vmn2r68 T C 7: 85,222,075 T667A probably damaging Het
Other mutations in Parp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Parp6 APN 9 59632959 missense probably damaging 1.00
IGL01366:Parp6 APN 9 59636713 missense possibly damaging 0.75
IGL01385:Parp6 APN 9 59630612 splice site probably benign
IGL02000:Parp6 APN 9 59648892 missense probably benign 0.00
IGL02001:Parp6 APN 9 59649961 missense possibly damaging 0.90
IGL02315:Parp6 APN 9 59641738 intron probably benign
IGL02719:Parp6 APN 9 59630738 missense probably benign 0.26
IGL02928:Parp6 APN 9 59641063 missense possibly damaging 0.70
IGL03169:Parp6 APN 9 59650017 nonsense probably null
IGL03398:Parp6 APN 9 59641053 missense probably damaging 0.97
R0165:Parp6 UTSW 9 59632925 missense probably damaging 1.00
R0602:Parp6 UTSW 9 59649365 splice site probably benign
R0781:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1110:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1730:Parp6 UTSW 9 59633538 nonsense probably null
R1783:Parp6 UTSW 9 59633538 nonsense probably null
R2264:Parp6 UTSW 9 59624005 missense probably damaging 1.00
R4323:Parp6 UTSW 9 59630686 missense possibly damaging 0.84
R4654:Parp6 UTSW 9 59641100 splice site probably null
R4672:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4673:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4708:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4709:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4763:Parp6 UTSW 9 59631365 missense probably damaging 1.00
R4782:Parp6 UTSW 9 59634984 splice site probably null
R4825:Parp6 UTSW 9 59624362 splice site probably null
R5700:Parp6 UTSW 9 59624727 missense probably damaging 1.00
R6235:Parp6 UTSW 9 59630815 missense probably benign 0.34
R6269:Parp6 UTSW 9 59650012 missense probably benign
R6383:Parp6 UTSW 9 59623939 missense probably damaging 0.99
X0061:Parp6 UTSW 9 59630765 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GAATCTTCTTGATCTCCCAGAATCC -3'
(R):5'- TACACAGGCCTGCAAAAGCTG -3'

Sequencing Primer
(F):5'- GATCTCCCAGAATCCTGTGTATG -3'
(R):5'- CCTGCAAAAGCTGGATATTGGC -3'
Posted On2016-10-24