Incidental Mutation 'R5563:Uba5'
ID436709
Institutional Source Beutler Lab
Gene Symbol Uba5
Ensembl Gene ENSMUSG00000032557
Gene Nameubiquitin-like modifier activating enzyme 5
SynonymsUbe1dc1, 5730525G14Rik
MMRRC Submission 043120-MU
Accession Numbers

Genbank: NM_025692; MGI: 1913913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5563 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104046599-104063134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104049247 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 372 (T372K)
Ref Sequence ENSEMBL: ENSMUSP00000035166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000140768] [ENSMUST00000144195]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
AA Change: T372K

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557
AA Change: T372K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140768
SMART Domains Protein: ENSMUSP00000118734
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 70 101 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144195
SMART Domains Protein: ENSMUSP00000118535
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
Pfam:ThiF 1 119 1.9e-22 PFAM
low complexity region 220 235 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193689
Predicted Effect probably benign
Transcript: ENSMUST00000214222
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die at E12.5. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Ighv3-1 T A 12: 113,964,586 Y51F probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mfsd4b2 C T 10: 39,922,042 E106K probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Parp6 G A 9: 59,628,673 probably null Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Prtg G A 9: 72,856,898 R551H probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Vmn2r68 T C 7: 85,222,075 T667A probably damaging Het
Other mutations in Uba5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Uba5 APN 9 104054060 splice site probably benign
IGL02891:Uba5 APN 9 104054193 splice site probably benign
IGL03182:Uba5 APN 9 104054129 missense possibly damaging 0.78
3-1:Uba5 UTSW 9 104060392 critical splice donor site probably null
PIT4810001:Uba5 UTSW 9 104055197 missense probably damaging 1.00
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0745:Uba5 UTSW 9 104049511 unclassified probably benign
R1018:Uba5 UTSW 9 104049903 missense probably benign 0.00
R1163:Uba5 UTSW 9 104055826 missense possibly damaging 0.70
R1771:Uba5 UTSW 9 104049908 missense probably damaging 1.00
R2164:Uba5 UTSW 9 104060243 missense probably damaging 1.00
R3916:Uba5 UTSW 9 104054190 missense probably damaging 1.00
R5072:Uba5 UTSW 9 104054427 missense probably damaging 1.00
R5177:Uba5 UTSW 9 104049298 missense probably benign
R6606:Uba5 UTSW 9 104055221 missense probably damaging 1.00
R7258:Uba5 UTSW 9 104062933 missense unknown
R7337:Uba5 UTSW 9 104055255 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTCAGTTTCAAATTTGCTGACACTG -3'
(R):5'- TTTTCTGGGAGGAAATAGAAGGTC -3'

Sequencing Primer
(F):5'- TTTGCTGACACTGAATATCTAGTTC -3'
(R):5'- CAGTGTTTTCTGGGAAGGAATATATG -3'
Posted On2016-10-24