Incidental Mutation 'R5564:Kcna10'
ID436731
Institutional Source Beutler Lab
Gene Symbol Kcna10
Ensembl Gene ENSMUSG00000042861
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 10
SynonymsKcna8, Kv1.8
MMRRC Submission 043121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5564 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107183056-107195721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107194229 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 59 (H59N)
Ref Sequence ENSEMBL: ENSMUSP00000088118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055064]
Predicted Effect probably benign
Transcript: ENSMUST00000055064
AA Change: H59N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088118
Gene: ENSMUSG00000042861
AA Change: H59N

DomainStartEndE-ValueType
BTB 86 186 1.07e-6 SMART
Pfam:Ion_trans 215 468 3.4e-51 PFAM
Pfam:Ion_trans_2 376 461 6.2e-16 PFAM
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significant vestibular and mild hearing dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,934,581 L1598M probably benign Het
Adam4 T C 12: 81,419,574 T758A probably benign Het
B3galnt2 T C 13: 13,995,229 I424T probably damaging Het
Cacna1g T C 11: 94,430,486 Y1316C probably damaging Het
Cacna2d1 T C 5: 16,312,519 S388P probably damaging Het
Ccdc157 A G 11: 4,148,765 L247S probably damaging Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Cdhr3 G T 12: 33,048,986 Y535* probably null Het
Clasp2 T C 9: 113,812,768 probably null Het
Col16a1 T A 4: 130,053,358 D165E probably damaging Het
Col9a1 A T 1: 24,195,355 probably benign Het
Cpa3 A T 3: 20,242,143 I10N possibly damaging Het
Cstf3 T A 2: 104,609,002 probably benign Het
Dnah3 C A 7: 119,971,466 probably null Het
E2f6 T C 12: 16,824,705 C263R probably benign Het
Eps8l2 C A 7: 141,356,621 Q288K possibly damaging Het
Fam193a T A 5: 34,420,855 V231D probably damaging Het
Gjc1 C T 11: 102,800,203 G325S probably benign Het
Gm5538 T C 3: 59,752,092 V322A probably benign Het
Gpatch8 T A 11: 102,538,285 E39D unknown Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Kansl3 G T 1: 36,345,964 H629N possibly damaging Het
Kitl A T 10: 100,080,024 E138D possibly damaging Het
Kpna2 T C 11: 106,990,745 K353R probably damaging Het
M1ap T A 6: 82,981,817 I143N probably damaging Het
Macf1 A G 4: 123,526,745 S239P possibly damaging Het
Med13l T A 5: 118,742,040 S1066T probably damaging Het
Mettl23 G T 11: 116,849,039 E47* probably null Het
Olfr312 C T 11: 58,831,213 Q20* probably null Het
Olfr556 T C 7: 102,670,226 F102S probably damaging Het
Proca1 T A 11: 78,201,873 D48E possibly damaging Het
Rab34 T G 11: 78,191,632 V227G probably damaging Het
Rab7 A T 6: 88,013,650 L14Q probably damaging Het
Rasgef1c C T 11: 49,957,107 S23F probably benign Het
Rit1 A G 3: 88,726,150 probably benign Het
Scin T C 12: 40,124,569 T172A probably benign Het
Scmh1 C A 4: 120,468,378 N97K probably damaging Het
Skint6 T C 4: 112,988,965 E655G possibly damaging Het
Slc22a15 A G 3: 101,864,589 V243A probably benign Het
Smg1 A G 7: 118,189,819 probably benign Het
Smim7 C T 8: 72,571,023 G3R probably damaging Het
Snurf C T 7: 59,995,534 R44H possibly damaging Het
Snx13 G A 12: 35,124,472 A667T possibly damaging Het
Sowaha T G 11: 53,478,763 H382P probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem259 G T 10: 79,978,608 probably null Het
Topbp1 A G 9: 103,334,078 T945A probably damaging Het
Tor1aip2 T C 1: 156,063,561 probably benign Het
Ube3b T C 5: 114,389,075 V118A probably damaging Het
Usp38 T C 8: 80,985,088 K773E probably damaging Het
Wnk1 G A 6: 119,948,891 probably benign Het
Zfp871 A G 17: 32,775,868 V111A possibly damaging Het
Other mutations in Kcna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Kcna10 APN 3 107194728 missense probably damaging 1.00
IGL00481:Kcna10 APN 3 107195514 missense probably benign
IGL00645:Kcna10 APN 3 107195465 missense possibly damaging 0.95
IGL00974:Kcna10 APN 3 107195331 missense probably damaging 1.00
IGL03108:Kcna10 APN 3 107194943 missense probably benign 0.00
R0020:Kcna10 UTSW 3 107195420 missense probably damaging 1.00
R0421:Kcna10 UTSW 3 107194504 missense probably damaging 1.00
R0811:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R0812:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R2176:Kcna10 UTSW 3 107194716 missense probably damaging 1.00
R4405:Kcna10 UTSW 3 107195465 missense possibly damaging 0.95
R4668:Kcna10 UTSW 3 107194694 missense possibly damaging 0.83
R4703:Kcna10 UTSW 3 107194610 missense probably benign 0.22
R4719:Kcna10 UTSW 3 107194901 missense probably benign
R4736:Kcna10 UTSW 3 107195492 missense probably benign
R5227:Kcna10 UTSW 3 107194428 missense probably damaging 1.00
R5735:Kcna10 UTSW 3 107195078 missense probably benign
R7418:Kcna10 UTSW 3 107195046 missense probably benign 0.12
R7464:Kcna10 UTSW 3 107194079 missense probably damaging 0.99
R7699:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7700:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7978:Kcna10 UTSW 3 107194347 missense probably damaging 1.00
R8068:Kcna10 UTSW 3 107194410 missense possibly damaging 0.58
R8744:Kcna10 UTSW 3 107194386 missense probably damaging 1.00
X0026:Kcna10 UTSW 3 107195157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCCCTAGAATGGATGTGTG -3'
(R):5'- GCCGTATTTTCCCACCAGAC -3'

Sequencing Primer
(F):5'- CTCCCTAGAATGGATGTGTGTAGCTG -3'
(R):5'- GATTCCATCAAAACTAGGTCTGTTTC -3'
Posted On2016-10-24