Incidental Mutation 'R5564:Clasp2'
ID436750
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 043121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5564 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 113812768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022] [ENSMUST00000216817]
Predicted Effect probably null
Transcript: ENSMUST00000111838
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163895
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163895
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166734
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166734
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213966
Predicted Effect probably null
Transcript: ENSMUST00000214522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214860
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Predicted Effect probably benign
Transcript: ENSMUST00000216817
Meta Mutation Damage Score 0.9477 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,934,581 L1598M probably benign Het
Adam4 T C 12: 81,419,574 T758A probably benign Het
B3galnt2 T C 13: 13,995,229 I424T probably damaging Het
Cacna1g T C 11: 94,430,486 Y1316C probably damaging Het
Cacna2d1 T C 5: 16,312,519 S388P probably damaging Het
Ccdc157 A G 11: 4,148,765 L247S probably damaging Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Cdhr3 G T 12: 33,048,986 Y535* probably null Het
Col16a1 T A 4: 130,053,358 D165E probably damaging Het
Col9a1 A T 1: 24,195,355 probably benign Het
Cpa3 A T 3: 20,242,143 I10N possibly damaging Het
Cstf3 T A 2: 104,609,002 probably benign Het
Dnah3 C A 7: 119,971,466 probably null Het
E2f6 T C 12: 16,824,705 C263R probably benign Het
Eps8l2 C A 7: 141,356,621 Q288K possibly damaging Het
Fam193a T A 5: 34,420,855 V231D probably damaging Het
Gjc1 C T 11: 102,800,203 G325S probably benign Het
Gm5538 T C 3: 59,752,092 V322A probably benign Het
Gpatch8 T A 11: 102,538,285 E39D unknown Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Kansl3 G T 1: 36,345,964 H629N possibly damaging Het
Kcna10 C A 3: 107,194,229 H59N probably benign Het
Kitl A T 10: 100,080,024 E138D possibly damaging Het
Kpna2 T C 11: 106,990,745 K353R probably damaging Het
M1ap T A 6: 82,981,817 I143N probably damaging Het
Macf1 A G 4: 123,526,745 S239P possibly damaging Het
Med13l T A 5: 118,742,040 S1066T probably damaging Het
Mettl23 G T 11: 116,849,039 E47* probably null Het
Olfr312 C T 11: 58,831,213 Q20* probably null Het
Olfr556 T C 7: 102,670,226 F102S probably damaging Het
Proca1 T A 11: 78,201,873 D48E possibly damaging Het
Rab34 T G 11: 78,191,632 V227G probably damaging Het
Rab7 A T 6: 88,013,650 L14Q probably damaging Het
Rasgef1c C T 11: 49,957,107 S23F probably benign Het
Rit1 A G 3: 88,726,150 probably benign Het
Scin T C 12: 40,124,569 T172A probably benign Het
Scmh1 C A 4: 120,468,378 N97K probably damaging Het
Skint6 T C 4: 112,988,965 E655G possibly damaging Het
Slc22a15 A G 3: 101,864,589 V243A probably benign Het
Smg1 A G 7: 118,189,819 probably benign Het
Smim7 C T 8: 72,571,023 G3R probably damaging Het
Snurf C T 7: 59,995,534 R44H possibly damaging Het
Snx13 G A 12: 35,124,472 A667T possibly damaging Het
Sowaha T G 11: 53,478,763 H382P probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem259 G T 10: 79,978,608 probably null Het
Topbp1 A G 9: 103,334,078 T945A probably damaging Het
Tor1aip2 T C 1: 156,063,561 probably benign Het
Ube3b T C 5: 114,389,075 V118A probably damaging Het
Usp38 T C 8: 80,985,088 K773E probably damaging Het
Wnk1 G A 6: 119,948,891 probably benign Het
Zfp871 A G 17: 32,775,868 V111A possibly damaging Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0458:Clasp2 UTSW 9 113906224 intron probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 intron probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
R7895:Clasp2 UTSW 9 113903948 missense probably benign 0.03
R7978:Clasp2 UTSW 9 113903948 missense probably benign 0.03
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113770221 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113908795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCTTGCAGCTGATTGG -3'
(R):5'- GGCATATTGTCACATTTCCCAC -3'

Sequencing Primer
(F):5'- TGTTGCAGCACCTAGGGCAG -3'
(R):5'- TTGTCACATTTCCCACATACAGAG -3'
Posted On2016-10-24