Mutagenetix > Incidental Mutation

Incidental Mutation 'R5564:Kitl'

436752

Institutional Source

Beutler Lab

Gene Symbol

Kitl

Ensembl Gene

ENSMUSG00000019966

Gene Name

kit ligand

Synonyms

Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor

MMRRC Submission

043121-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.424) question?

Stock #

R5564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100015630-100100416 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100080024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 138 (E138D)

Ref Sequence

ENSEMBL: ENSMUSP00000100920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]

AlphaFold

P20826

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020129
AA Change: E138D

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: E138D

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105283
AA Change: E138D

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: E138D

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130190

SMART Domains

Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	43	160	1.1e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218200

Meta Mutation Damage Score

0.4895

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	T	11: 109,934,581	L1598M	probably benign	Het
Adam4	T	C	12: 81,419,574	T758A	probably benign	Het
B3galnt2	T	C	13: 13,995,229	I424T	probably damaging	Het
Cacna1g	T	C	11: 94,430,486	Y1316C	probably damaging	Het
Cacna2d1	T	C	5: 16,312,519	S388P	probably damaging	Het
Ccdc157	A	G	11: 4,148,765	L247S	probably damaging	Het
Cdh8	A	G	8: 99,030,866	I700T	possibly damaging	Het
Cdhr3	G	T	12: 33,048,986	Y535*	probably null	Het
Clasp2	T	C	9: 113,812,768		probably null	Het
Col16a1	T	A	4: 130,053,358	D165E	probably damaging	Het
Col9a1	A	T	1: 24,195,355		probably benign	Het
Cpa3	A	T	3: 20,242,143	I10N	possibly damaging	Het
Cstf3	T	A	2: 104,609,002		probably benign	Het
Dnah3	C	A	7: 119,971,466		probably null	Het
E2f6	T	C	12: 16,824,705	C263R	probably benign	Het
Eps8l2	C	A	7: 141,356,621	Q288K	possibly damaging	Het
Fam193a	T	A	5: 34,420,855	V231D	probably damaging	Het
Gjc1	C	T	11: 102,800,203	G325S	probably benign	Het
Gm5538	T	C	3: 59,752,092	V322A	probably benign	Het
Gpatch8	T	A	11: 102,538,285	E39D	unknown	Het
Gpr107	C	T	2: 31,152,363	A2V	probably damaging	Het
Kansl3	G	T	1: 36,345,964	H629N	possibly damaging	Het
Kcna10	C	A	3: 107,194,229	H59N	probably benign	Het
Kpna2	T	C	11: 106,990,745	K353R	probably damaging	Het
M1ap	T	A	6: 82,981,817	I143N	probably damaging	Het
Macf1	A	G	4: 123,526,745	S239P	possibly damaging	Het
Med13l	T	A	5: 118,742,040	S1066T	probably damaging	Het
Mettl23	G	T	11: 116,849,039	E47*	probably null	Het
Olfr312	C	T	11: 58,831,213	Q20*	probably null	Het
Olfr556	T	C	7: 102,670,226	F102S	probably damaging	Het
Proca1	T	A	11: 78,201,873	D48E	possibly damaging	Het
Rab34	T	G	11: 78,191,632	V227G	probably damaging	Het
Rab7	A	T	6: 88,013,650	L14Q	probably damaging	Het
Rasgef1c	C	T	11: 49,957,107	S23F	probably benign	Het
Rit1	A	G	3: 88,726,150		probably benign	Het
Scin	T	C	12: 40,124,569	T172A	probably benign	Het
Scmh1	C	A	4: 120,468,378	N97K	probably damaging	Het
Skint6	T	C	4: 112,988,965	E655G	possibly damaging	Het
Slc22a15	A	G	3: 101,864,589	V243A	probably benign	Het
Smg1	A	G	7: 118,189,819		probably benign	Het
Smim7	C	T	8: 72,571,023	G3R	probably damaging	Het
Snurf	C	T	7: 59,995,534	R44H	possibly damaging	Het
Snx13	G	A	12: 35,124,472	A667T	possibly damaging	Het
Sowaha	T	G	11: 53,478,763	H382P	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmem259	G	T	10: 79,978,608		probably null	Het
Topbp1	A	G	9: 103,334,078	T945A	probably damaging	Het
Tor1aip2	T	C	1: 156,063,561		probably benign	Het
Ube3b	T	C	5: 114,389,075	V118A	probably damaging	Het
Usp38	T	C	8: 80,985,088	K773E	probably damaging	Het
Wnk1	G	A	6: 119,948,891		probably benign	Het
Zfp871	A	G	17: 32,775,868	V111A	possibly damaging	Het

Other mutations in Kitl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Kitl	APN	10	100087344	splice site	probably benign
IGL02066:Kitl	APN	10	100076882	missense	probably damaging	1.00
IGL03211:Kitl	APN	10	100080859	missense	probably benign	0.19
Gregory	UTSW	10	100076906	critical splice donor site	probably null
mooyah	UTSW	10	100088222	critical splice donor site	probably null
Sandycheeks	UTSW	10	100076906	critical splice donor site	probably null
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0132:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R1554:Kitl	UTSW	10	100087438	missense	probably benign	0.38
R1649:Kitl	UTSW	10	100064114	missense	probably benign	0.03
R2194:Kitl	UTSW	10	100016037	critical splice donor site	probably null
R2254:Kitl	UTSW	10	100080131	critical splice donor site	probably null
R4877:Kitl	UTSW	10	100080866	missense	probably damaging	1.00
R5135:Kitl	UTSW	10	100088222	critical splice donor site	probably null
R5453:Kitl	UTSW	10	100087385	missense	probably damaging	1.00
R5832:Kitl	UTSW	10	100080020	missense	probably damaging	1.00
R5971:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6043:Kitl	UTSW	10	100064085	missense	probably damaging	1.00
R6067:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6138:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6255:Kitl	UTSW	10	100089233	makesense	probably null
R6450:Kitl	UTSW	10	100087394	start codon destroyed	probably null	0.00
R6588:Kitl	UTSW	10	100064092	missense	probably damaging	1.00
R6951:Kitl	UTSW	10	100051852	missense	probably damaging	1.00
R7315:Kitl	UTSW	10	100016112	missense	unknown
R7368:Kitl	UTSW	10	100016081	missense	probably benign	0.02
R8010:Kitl	UTSW	10	100051903	missense	probably benign	0.22
R8234:Kitl	UTSW	10	100051846	missense	probably damaging	1.00
R9613:Kitl	UTSW	10	100080919	missense	probably damaging	1.00
U15987:Kitl	UTSW	10	100076906	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTCTGTAGCCATTTTGAGTTGAGTC -3'
(R):5'- AGTTCATCCAGCAGGGGAAG -3'

Sequencing Primer
(F):5'- CTGTTGGCTTGCAGAGTTCAAATACC -3'
(R):5'- CAGGGGAAGCTTATAAAAGTTCAATC -3'

Posted On

2016-10-24