Incidental Mutation 'R5564:B3galnt2'
ID436769
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
MMRRC Submission 043121-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5564 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13995229 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 424 (I424T)
Ref Sequence ENSEMBL: ENSMUSP00000152397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039894] [ENSMUST00000099747] [ENSMUST00000159893] [ENSMUST00000162326] [ENSMUST00000220681] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000223483] [ENSMUST00000222110]
Predicted Effect probably benign
Transcript: ENSMUST00000039894
SMART Domains Protein: ENSMUSP00000047880
Gene: ENSMUSG00000039233

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-20 SMART
low complexity region 347 360 N/A INTRINSIC
Pfam:Ubiquitin_2 442 523 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099747
AA Change: I424T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242
AA Change: I424T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159893
SMART Domains Protein: ENSMUSP00000125244
Gene: ENSMUSG00000039233

DomainStartEndE-ValueType
SCOP:d1lpla_ 9 35 3e-5 SMART
Blast:CAP_GLY 10 34 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160553
Predicted Effect probably benign
Transcript: ENSMUST00000162326
SMART Domains Protein: ENSMUSP00000125613
Gene: ENSMUSG00000039233

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-21 SMART
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220681
AA Change: I205T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220932
Predicted Effect probably damaging
Transcript: ENSMUST00000221300
AA Change: I424T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000221333
Predicted Effect probably damaging
Transcript: ENSMUST00000221974
AA Change: I424T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000222420
AA Change: I25T
Predicted Effect probably benign
Transcript: ENSMUST00000223483
Predicted Effect probably benign
Transcript: ENSMUST00000222110
Meta Mutation Damage Score 0.6677 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,934,581 L1598M probably benign Het
Adam4 T C 12: 81,419,574 T758A probably benign Het
Cacna1g T C 11: 94,430,486 Y1316C probably damaging Het
Cacna2d1 T C 5: 16,312,519 S388P probably damaging Het
Ccdc157 A G 11: 4,148,765 L247S probably damaging Het
Cdh8 A G 8: 99,030,866 I700T possibly damaging Het
Cdhr3 G T 12: 33,048,986 Y535* probably null Het
Clasp2 T C 9: 113,812,768 probably null Het
Col16a1 T A 4: 130,053,358 D165E probably damaging Het
Col9a1 A T 1: 24,195,355 probably benign Het
Cpa3 A T 3: 20,242,143 I10N possibly damaging Het
Cstf3 T A 2: 104,609,002 probably benign Het
Dnah3 C A 7: 119,971,466 probably null Het
E2f6 T C 12: 16,824,705 C263R probably benign Het
Eps8l2 C A 7: 141,356,621 Q288K possibly damaging Het
Fam193a T A 5: 34,420,855 V231D probably damaging Het
Gjc1 C T 11: 102,800,203 G325S probably benign Het
Gm5538 T C 3: 59,752,092 V322A probably benign Het
Gpatch8 T A 11: 102,538,285 E39D unknown Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Kansl3 G T 1: 36,345,964 H629N possibly damaging Het
Kcna10 C A 3: 107,194,229 H59N probably benign Het
Kitl A T 10: 100,080,024 E138D possibly damaging Het
Kpna2 T C 11: 106,990,745 K353R probably damaging Het
M1ap T A 6: 82,981,817 I143N probably damaging Het
Macf1 A G 4: 123,526,745 S239P possibly damaging Het
Med13l T A 5: 118,742,040 S1066T probably damaging Het
Mettl23 G T 11: 116,849,039 E47* probably null Het
Olfr312 C T 11: 58,831,213 Q20* probably null Het
Olfr556 T C 7: 102,670,226 F102S probably damaging Het
Proca1 T A 11: 78,201,873 D48E possibly damaging Het
Rab34 T G 11: 78,191,632 V227G probably damaging Het
Rab7 A T 6: 88,013,650 L14Q probably damaging Het
Rasgef1c C T 11: 49,957,107 S23F probably benign Het
Rit1 A G 3: 88,726,150 probably benign Het
Scin T C 12: 40,124,569 T172A probably benign Het
Scmh1 C A 4: 120,468,378 N97K probably damaging Het
Skint6 T C 4: 112,988,965 E655G possibly damaging Het
Slc22a15 A G 3: 101,864,589 V243A probably benign Het
Smg1 A G 7: 118,189,819 probably benign Het
Smim7 C T 8: 72,571,023 G3R probably damaging Het
Snurf C T 7: 59,995,534 R44H possibly damaging Het
Snx13 G A 12: 35,124,472 A667T possibly damaging Het
Sowaha T G 11: 53,478,763 H382P probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem259 G T 10: 79,978,608 probably null Het
Topbp1 A G 9: 103,334,078 T945A probably damaging Het
Tor1aip2 T C 1: 156,063,561 probably benign Het
Ube3b T C 5: 114,389,075 V118A probably damaging Het
Usp38 T C 8: 80,985,088 K773E probably damaging Het
Wnk1 G A 6: 119,948,891 probably benign Het
Zfp871 A G 17: 32,775,868 V111A possibly damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3686:B3galnt2 UTSW 13 13975635 critical splice donor site probably null
R3954:B3galnt2 UTSW 13 13966454 missense probably benign 0.04
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R6656:B3galnt2 UTSW 13 13975576 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7582:B3galnt2 UTSW 13 13991401 missense probably damaging 1.00
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
R8135:B3galnt2 UTSW 13 13970869 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTTTCCTTAGGCAGCAAG -3'
(R):5'- TGAGAAGTGTCAGGTAAATGTCC -3'

Sequencing Primer
(F):5'- GGCAGCAAGAATCTTTTTCCTG -3'
(R):5'- GTCCCTGATCTTTAGGGAGTAACTC -3'
Posted On2016-10-24