Mutagenetix > Incidental Mutations

Incidental Mutation 'R5566:Eif5b'

436773

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

A030003E17Rik, IF2

MMRRC Submission

043123-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37998010-38055579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38051247 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 1169 (G1169E)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]

Predicted Effect

probably benign
Transcript: ENSMUST00000027251

SMART Domains

Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

Domain	Start	End	E-Value	Type
BRCT	46	121	3.99e-13	SMART
low complexity region	320	342	N/A	INTRINSIC
Pfam:IMS	420	620	1.9e-43	PFAM
Pfam:IMS_C	700	831	5.8e-20	PFAM
low complexity region	888	901	N/A	INTRINSIC
Pfam:DUF4414	938	1071	9.7e-11	PFAM
Pfam:REV1_C	1127	1248	1.2e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000027252
AA Change: G1169E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: G1169E

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193151

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195664

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38041719	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38036098	missense	probably benign
IGL01395:Eif5b	APN	1	38037258	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38022254	nonsense	probably null
IGL01615:Eif5b	APN	1	38045706	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38032322	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38045456	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38041747	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38036269	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38041691	splice site	probably benign
R0018:Eif5b	UTSW	1	38018889	missense	unknown
R0036:Eif5b	UTSW	1	38019111	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38019243	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38032366	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38048893	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38022167	missense	unknown
R1225:Eif5b	UTSW	1	38037628	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38041819	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38048794	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38019223	missense	unknown
R2432:Eif5b	UTSW	1	38019342	missense	unknown
R2922:Eif5b	UTSW	1	38018019	splice site	probably benign
R4357:Eif5b	UTSW	1	38050258	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38041747	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38045712	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38018877	missense	unknown
R4941:Eif5b	UTSW	1	38051199	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38051711	makesense	probably null
R5020:Eif5b	UTSW	1	38019069	nonsense	probably null
R5175:Eif5b	UTSW	1	38045387	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38045754	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38045684	missense	possibly damaging	0.90
R5853:Eif5b	UTSW	1	38037307	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	37998280	splice site	probably null
R6315:Eif5b	UTSW	1	38018033	missense	unknown
R6376:Eif5b	UTSW	1	38045679	missense	probably damaging	0.98
R6388:Eif5b	UTSW	1	38019000	missense	unknown
R6444:Eif5b	UTSW	1	38036211	missense	probably damaging	1.00
R6455:Eif5b	UTSW	1	38019027	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38046660	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38050239	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38041776	missense	probably damaging	1.00
R7180:Eif5b	UTSW	1	38049074	missense	probably damaging	0.98
R7439:Eif5b	UTSW	1	38051637	missense	probably benign	0.28
R7488:Eif5b	UTSW	1	38050306	missense	possibly damaging	0.69
R8140:Eif5b	UTSW	1	38051276	missense	probably benign	0.41
R8166:Eif5b	UTSW	1	38048820	missense	probably benign	0.11
R8191:Eif5b	UTSW	1	38036202	missense	probably damaging	0.98
R8304:Eif5b	UTSW	1	38045693	missense	probably benign	0.11
RF018:Eif5b	UTSW	1	38021592	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTGGACACTGCAGGGTTAG -3'
(R):5'- GCACTACCGCTGTCTATCAGAATC -3'

Sequencing Primer
(F):5'- CACTGCAGGGTTAGACCAAGC -3'
(R):5'- CTGTCTATCAGAATCAACACCTGATG -3'

Posted On

2016-10-24