Incidental Mutation 'R5566:Aff3'
ID436774
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38181424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1135 (S1135F)
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027]
Predicted Effect probably damaging
Transcript: ENSMUST00000039827
AA Change: S1134F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138
AA Change: S1134F

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095027
AA Change: S1135F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138
AA Change: S1135F

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136641
SMART Domains Protein: ENSMUSP00000114638
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 1 253 1.8e-118 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38538963 missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38210362 missense probably benign 0.01
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R0742:Aff3 UTSW 1 38627108 missense probably damaging 0.99
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1255:Aff3 UTSW 1 38204884 splice site probably null
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1780:Aff3 UTSW 1 38535702 missense probably damaging 1.00
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R2970:Aff3 UTSW 1 38535022 missense probably damaging 0.97
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38181613 critical splice donor site probably null
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R7187:Aff3 UTSW 1 38218397 missense probably damaging 0.98
R8322:Aff3 UTSW 1 38181661 missense possibly damaging 0.65
R8329:Aff3 UTSW 1 38205054 missense probably benign 0.13
Z1176:Aff3 UTSW 1 38329872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATATTTCCCTGTGCCTG -3'
(R):5'- GTTCACTTTCCCCAAATGCAG -3'

Sequencing Primer
(F):5'- ATTCTCCAGGGCTTGTGCAC -3'
(R):5'- TGCAGATAAACCACGCATTGCATG -3'
Posted On2016-10-24