Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Rgsl1'

436777

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153793774 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 289 (I289F)

Ref Sequence

ENSEMBL: ENSMUSP00000139215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124558
AA Change: I969F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: I969F

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably damaging
Transcript: ENSMUST00000141249
AA Change: I289F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641
AA Change: I289F

Domain	Start	End	E-Value	Type
Blast:RGS	3	300	3e-30	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145308

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGATCCCAGGAGGCATAAG -3'
(R):5'- GGGGTCACTAGAGGTCATTTTCC -3'

Sequencing Primer
(F):5'- AGGTGTGGAGCCAGCATTC -3'
(R):5'- AGAGGTCATTTTCCTTTCCTGCAG -3'

Posted On

2016-10-24