Incidental Mutation 'R5566:Jade1'
ID436791
Institutional Source Beutler Lab
Gene Symbol Jade1
Ensembl Gene ENSMUSG00000025764
Gene Namejade family PHD finger 1
SynonymsD530048A03Rik, Phf17
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location41555731-41616864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41604903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 473 (D473G)
Ref Sequence ENSEMBL: ENSMUSP00000141499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026865] [ENSMUST00000163764] [ENSMUST00000168086] [ENSMUST00000170711] [ENSMUST00000191952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026865
AA Change: D473G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026865
Gene: ENSMUSG00000025764
AA Change: D473G

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163764
AA Change: D473G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128152
Gene: ENSMUSG00000025764
AA Change: D473G

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168086
AA Change: D473G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131441
Gene: ENSMUSG00000025764
AA Change: D473G

DomainStartEndE-ValueType
Pfam:EPL1 31 182 5.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170711
AA Change: D473G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127113
Gene: ENSMUSG00000025764
AA Change: D473G

DomainStartEndE-ValueType
Pfam:EPL1 5 182 1.5e-9 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 817 831 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191921
Predicted Effect possibly damaging
Transcript: ENSMUST00000191952
AA Change: D473G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141499
Gene: ENSMUSG00000025764
AA Change: D473G

DomainStartEndE-ValueType
Pfam:EPL1 30 182 2.3e-23 PFAM
PHD 206 252 1.91e-10 SMART
PHD 315 370 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192300
Predicted Effect probably benign
Transcript: ENSMUST00000192451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195322
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Though mice homozygous for mutations of this locus show no overt phenotype at birth, fewer survive to weaning than expected by Mendelian ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Jade1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Jade1 APN 3 41613502 missense probably benign 0.01
IGL01564:Jade1 APN 3 41596649 missense possibly damaging 0.91
IGL02428:Jade1 APN 3 41613939 missense probably benign 0.03
IGL03080:Jade1 APN 3 41600075 nonsense probably null
R0763:Jade1 UTSW 3 41613783 missense possibly damaging 0.93
R1539:Jade1 UTSW 3 41604996 missense probably benign 0.00
R1576:Jade1 UTSW 3 41591807 missense probably damaging 1.00
R1826:Jade1 UTSW 3 41613213 missense probably damaging 1.00
R2143:Jade1 UTSW 3 41604708 missense probably benign
R2255:Jade1 UTSW 3 41591750 missense probably damaging 1.00
R2843:Jade1 UTSW 3 41604845 missense probably damaging 0.98
R2962:Jade1 UTSW 3 41613327 missense probably benign
R3963:Jade1 UTSW 3 41601410 missense probably damaging 0.98
R4753:Jade1 UTSW 3 41596671 nonsense probably null
R4971:Jade1 UTSW 3 41601401 missense probably damaging 1.00
R5278:Jade1 UTSW 3 41589009 missense possibly damaging 0.84
R5327:Jade1 UTSW 3 41613978 missense possibly damaging 0.60
R5384:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5385:Jade1 UTSW 3 41591702 missense probably damaging 1.00
R5531:Jade1 UTSW 3 41613511 missense probably benign 0.27
R5776:Jade1 UTSW 3 41613792 missense probably benign 0.27
R6299:Jade1 UTSW 3 41613725 missense probably damaging 1.00
R6520:Jade1 UTSW 3 41604482 missense possibly damaging 0.46
R7481:Jade1 UTSW 3 41604690 missense probably benign
R7951:Jade1 UTSW 3 41591755 missense probably damaging 0.99
R8006:Jade1 UTSW 3 41613689 missense probably benign
R8175:Jade1 UTSW 3 41613288 missense probably benign 0.27
R8493:Jade1 UTSW 3 41604678 missense possibly damaging 0.60
X0026:Jade1 UTSW 3 41613413 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGAGCCCTATGGTAGTC -3'
(R):5'- TGACTGGCTATCATCTCTAGGC -3'

Sequencing Primer
(F):5'- CCTATGGTAGTCTGGAGCCGAATC -3'
(R):5'- ACTGGCTATCATCTCTAGGCAAGTG -3'
Posted On2016-10-24