Incidental Mutation 'R0046:Dhx9'
ID43680
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 038340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0046 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153472707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 291 (V291M)
Ref Sequence ENSEMBL: ENSMUSP00000139825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect probably benign
Transcript: ENSMUST00000042141
AA Change: V292M

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: V292M

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186380
AA Change: V291M

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: V291M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
AA Change: V291M

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699
AA Change: V291M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188345
AA Change: V292M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: V292M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189516
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 K135* probably null Het
Adamts16 A G 13: 70,763,460 S871P probably benign Het
Adcy10 A T 1: 165,539,834 I558F probably damaging Het
Adsl T G 15: 80,962,788 probably null Het
Aldob T C 4: 49,543,842 I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 E46G probably damaging Het
Ankrd33b G A 15: 31,367,337 P19L probably damaging Het
Apoa5 T C 9: 46,269,998 L124S probably damaging Het
Atp1a4 A T 1: 172,240,097 L533Q probably benign Het
Atp7b T C 8: 22,059,995 T9A probably benign Het
Auh G A 13: 52,929,385 probably benign Het
B3gnt3 T C 8: 71,692,923 Y267C probably damaging Het
BC051142 T C 17: 34,460,121 probably null Het
Card11 T C 5: 140,908,524 T117A possibly damaging Het
Ccdc39 A G 3: 33,844,152 F15L possibly damaging Het
Chtf18 C T 17: 25,723,460 R468Q probably benign Het
Cntnap5c T G 17: 58,359,300 D1108E probably benign Het
Col14a1 G A 15: 55,408,963 probably benign Het
Col6a6 C T 9: 105,748,848 probably benign Het
Col9a3 G A 2: 180,609,487 A317T possibly damaging Het
Cpt1c A T 7: 44,959,832 probably benign Het
Cpt2 A G 4: 107,904,362 probably null Het
Crebrf T A 17: 26,763,334 L565M probably damaging Het
Cyp2d41-ps T A 15: 82,782,035 noncoding transcript Het
Dmxl1 T A 18: 49,878,082 V1102E probably benign Het
Dnah7a A T 1: 53,456,874 probably null Het
Dock4 G A 12: 40,737,360 probably benign Het
Dpp3 G T 19: 4,914,643 N545K probably damaging Het
Elmo2 T A 2: 165,298,726 N275I probably damaging Het
Farp1 A G 14: 121,255,513 K509R probably benign Het
Fat3 T C 9: 15,965,979 Y3446C possibly damaging Het
Fgd2 T A 17: 29,374,990 probably benign Het
Flg T A 3: 93,277,721 probably benign Het
Gas2l2 A T 11: 83,421,910 W859R probably damaging Het
Gatm T C 2: 122,600,744 D254G probably damaging Het
Gjd4 T A 18: 9,280,998 I27F probably damaging Het
Gsdmc2 C A 15: 63,827,755 probably benign Het
Haus5 C T 7: 30,654,180 V591I probably benign Het
Kcnab3 G A 11: 69,330,227 probably null Het
Khdrbs2 A G 1: 32,619,202 D281G possibly damaging Het
Krt86 A T 15: 101,477,402 M393L probably benign Het
Limk1 T C 5: 134,672,761 Y96C probably damaging Het
Lrp2bp T A 8: 46,013,155 Y100* probably null Het
Mamstr T G 7: 45,641,770 probably benign Het
Man1a A G 10: 53,919,187 Y657H probably damaging Het
Marf1 G A 16: 14,111,727 P1672S possibly damaging Het
Mboat7 T C 7: 3,683,818 Y341C probably damaging Het
Nhsl1 A T 10: 18,525,669 N881I probably damaging Het
Nox3 T C 17: 3,682,961 Y225C probably benign Het
Nrp1 C T 8: 128,500,608 probably benign Het
Olfr1080 A G 2: 86,553,632 F164S probably damaging Het
Olfr1214 C T 2: 88,987,349 M284I probably benign Het
Olfr1260 C T 2: 89,978,507 T243I probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr742 T A 14: 50,516,139 *312K probably null Het
Pcdhb13 A T 18: 37,444,257 M563L probably benign Het
Pclo C T 5: 14,540,479 T931M unknown Het
Peli2 C T 14: 48,121,202 P16S possibly damaging Het
Pfas G T 11: 68,990,467 R1025S probably benign Het
Pik3c2a A T 7: 116,354,072 I1196N probably damaging Het
Pmfbp1 A T 8: 109,535,985 probably benign Het
Prg4 T C 1: 150,456,086 T279A possibly damaging Het
Psma1 A T 7: 114,267,205 probably benign Het
Rab11fip1 A G 8: 27,153,121 L550P probably damaging Het
Rgs12 T A 5: 34,965,320 I149N probably damaging Het
Rmnd5a T C 6: 71,399,231 H195R probably damaging Het
Rnf17 T C 14: 56,471,373 L750P probably damaging Het
Rtcb T C 10: 85,957,656 N18D probably benign Het
Seh1l T C 18: 67,792,016 probably null Het
Sis T G 3: 72,932,094 N813T probably benign Het
Sptbn2 T C 19: 4,745,377 probably benign Het
Stag3 C T 5: 138,283,023 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taok3 C T 5: 117,272,229 Q829* probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttn A G 2: 76,951,542 probably benign Het
Unc79 A G 12: 103,125,681 E1756G probably damaging Het
Usp35 A T 7: 97,313,597 probably null Het
Vmn2r111 A G 17: 22,548,009 F836L probably benign Het
Vmn2r77 A G 7: 86,801,938 D344G possibly damaging Het
Zbtb40 A G 4: 136,987,278 C1067R probably damaging Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAACCACTCCCACTGCATTTTGTC -3'
(R):5'- TTAGCAGCACAGTCATGTGCCCTC -3'

Sequencing Primer
(F):5'- GGTTCAAAATGAGCCAATTTCCC -3'
(R):5'- AGGCTTACTCTGGGCTTACAAAG -3'
Posted On2013-05-29