Incidental Mutation 'R0046:Dhx9'
ID 43680
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene Name DExH-box helicase 9
Synonyms Ddx9, NDHII, nuclear DNA helicase II, leukophysin, NDH II, RNA helicase, RHA
MMRRC Submission 038340-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0046 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 153331504-153363406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 153348453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 291 (V291M)
Ref Sequence ENSEMBL: ENSMUSP00000139825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042141
AA Change: V292M

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: V292M

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186380
AA Change: V291M

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: V291M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
AA Change: V291M

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699
AA Change: V291M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188345
AA Change: V292M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: V292M

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189516
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A T 4: 56,743,877 (GRCm39) K135* probably null Het
Adamts16 A G 13: 70,911,579 (GRCm39) S871P probably benign Het
Adcy10 A T 1: 165,367,403 (GRCm39) I558F probably damaging Het
Adsl T G 15: 80,846,989 (GRCm39) probably null Het
Aldob T C 4: 49,543,842 (GRCm39) I47V possibly damaging Het
Alkbh8 A G 9: 3,343,247 (GRCm39) E46G probably damaging Het
Ankrd33b G A 15: 31,367,483 (GRCm39) P19L probably damaging Het
Apoa5 T C 9: 46,181,296 (GRCm39) L124S probably damaging Het
Atp1a4 A T 1: 172,067,664 (GRCm39) L533Q probably benign Het
Atp7b T C 8: 22,550,011 (GRCm39) T9A probably benign Het
Auh G A 13: 53,083,421 (GRCm39) probably benign Het
B3gnt3 T C 8: 72,145,567 (GRCm39) Y267C probably damaging Het
Card11 T C 5: 140,894,279 (GRCm39) T117A possibly damaging Het
Ccdc39 A G 3: 33,898,301 (GRCm39) F15L possibly damaging Het
Chtf18 C T 17: 25,942,434 (GRCm39) R468Q probably benign Het
Cntnap5c T G 17: 58,666,295 (GRCm39) D1108E probably benign Het
Col14a1 G A 15: 55,272,359 (GRCm39) probably benign Het
Col6a6 C T 9: 105,626,047 (GRCm39) probably benign Het
Col9a3 G A 2: 180,251,280 (GRCm39) A317T possibly damaging Het
Cpt1c A T 7: 44,609,256 (GRCm39) probably benign Het
Cpt2 A G 4: 107,761,559 (GRCm39) probably null Het
Crebrf T A 17: 26,982,308 (GRCm39) L565M probably damaging Het
Cyp2d41-ps T A 15: 82,666,236 (GRCm39) noncoding transcript Het
Dmxl1 T A 18: 50,011,149 (GRCm39) V1102E probably benign Het
Dnah7a A T 1: 53,496,033 (GRCm39) probably null Het
Dock4 G A 12: 40,787,359 (GRCm39) probably benign Het
Dpp3 G T 19: 4,964,671 (GRCm39) N545K probably damaging Het
Elmo2 T A 2: 165,140,646 (GRCm39) N275I probably damaging Het
Farp1 A G 14: 121,492,925 (GRCm39) K509R probably benign Het
Fat3 T C 9: 15,877,275 (GRCm39) Y3446C possibly damaging Het
Fgd2 T A 17: 29,593,964 (GRCm39) probably benign Het
Flg T A 3: 93,185,028 (GRCm39) probably benign Het
Gas2l2 A T 11: 83,312,736 (GRCm39) W859R probably damaging Het
Gatm T C 2: 122,431,225 (GRCm39) D254G probably damaging Het
Gjd4 T A 18: 9,280,998 (GRCm39) I27F probably damaging Het
Gsdmc2 C A 15: 63,699,604 (GRCm39) probably benign Het
Haus5 C T 7: 30,353,605 (GRCm39) V591I probably benign Het
Kcnab3 G A 11: 69,221,053 (GRCm39) probably null Het
Khdrbs2 A G 1: 32,658,283 (GRCm39) D281G possibly damaging Het
Krt86 A T 15: 101,375,283 (GRCm39) M393L probably benign Het
Limk1 T C 5: 134,701,615 (GRCm39) Y96C probably damaging Het
Lrp2bp T A 8: 46,466,192 (GRCm39) Y100* probably null Het
Mamstr T G 7: 45,291,194 (GRCm39) probably benign Het
Man1a A G 10: 53,795,283 (GRCm39) Y657H probably damaging Het
Marf1 G A 16: 13,929,591 (GRCm39) P1672S possibly damaging Het
Mboat7 T C 7: 3,686,817 (GRCm39) Y341C probably damaging Het
Nhsl1 A T 10: 18,401,417 (GRCm39) N881I probably damaging Het
Nox3 T C 17: 3,733,236 (GRCm39) Y225C probably benign Het
Nrp1 C T 8: 129,227,089 (GRCm39) probably benign Het
Or11g26 T A 14: 50,753,596 (GRCm39) *312K probably null Het
Or4c109 C T 2: 88,817,693 (GRCm39) M284I probably benign Het
Or4c35 C T 2: 89,808,851 (GRCm39) T243I probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or8k33 A G 2: 86,383,976 (GRCm39) F164S probably damaging Het
Pcdhb13 A T 18: 37,577,310 (GRCm39) M563L probably benign Het
Pclo C T 5: 14,590,493 (GRCm39) T931M unknown Het
Peli2 C T 14: 48,358,659 (GRCm39) P16S possibly damaging Het
Pfas G T 11: 68,881,293 (GRCm39) R1025S probably benign Het
Pik3c2a A T 7: 115,953,307 (GRCm39) I1196N probably damaging Het
Pmfbp1 A T 8: 110,262,617 (GRCm39) probably benign Het
Prg4 T C 1: 150,331,837 (GRCm39) T279A possibly damaging Het
Psma1 A T 7: 113,866,440 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,643,149 (GRCm39) L550P probably damaging Het
Rgs12 T A 5: 35,122,664 (GRCm39) I149N probably damaging Het
Rmnd5a T C 6: 71,376,215 (GRCm39) H195R probably damaging Het
Rnf17 T C 14: 56,708,830 (GRCm39) L750P probably damaging Het
Rtcb T C 10: 85,793,520 (GRCm39) N18D probably benign Het
Seh1l T C 18: 67,925,086 (GRCm39) probably null Het
Sis T G 3: 72,839,427 (GRCm39) N813T probably benign Het
Sptbn2 T C 19: 4,795,405 (GRCm39) probably benign Het
Stag3 C T 5: 138,281,285 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Taok3 C T 5: 117,410,294 (GRCm39) Q829* probably null Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tsbp1 T C 17: 34,679,095 (GRCm39) probably null Het
Ttn A G 2: 76,781,886 (GRCm39) probably benign Het
Unc79 A G 12: 103,091,940 (GRCm39) E1756G probably damaging Het
Usp35 A T 7: 96,962,804 (GRCm39) probably null Het
Vmn2r111 A G 17: 22,766,990 (GRCm39) F836L probably benign Het
Vmn2r77 A G 7: 86,451,146 (GRCm39) D344G possibly damaging Het
Zbtb40 A G 4: 136,714,589 (GRCm39) C1067R probably damaging Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153,341,494 (GRCm39) missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153,340,644 (GRCm39) missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153,335,312 (GRCm39) missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153,344,614 (GRCm39) splice site probably benign
IGL02938:Dhx9 APN 1 153,340,376 (GRCm39) missense probably benign 0.37
R0001:Dhx9 UTSW 1 153,338,382 (GRCm39) missense probably damaging 1.00
R0309:Dhx9 UTSW 1 153,341,441 (GRCm39) missense probably benign 0.00
R0517:Dhx9 UTSW 1 153,354,662 (GRCm39) missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153,348,037 (GRCm39) missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153,334,109 (GRCm39) missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153,340,684 (GRCm39) missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153,340,684 (GRCm39) missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153,359,493 (GRCm39) missense probably benign 0.44
R1456:Dhx9 UTSW 1 153,341,441 (GRCm39) missense probably benign 0.00
R1460:Dhx9 UTSW 1 153,341,426 (GRCm39) missense probably benign 0.01
R1724:Dhx9 UTSW 1 153,334,234 (GRCm39) missense probably benign 0.00
R1848:Dhx9 UTSW 1 153,341,499 (GRCm39) missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153,336,020 (GRCm39) splice site probably null
R2001:Dhx9 UTSW 1 153,331,857 (GRCm39) nonsense probably null
R3084:Dhx9 UTSW 1 153,341,445 (GRCm39) missense probably benign 0.34
R3085:Dhx9 UTSW 1 153,341,445 (GRCm39) missense probably benign 0.34
R3123:Dhx9 UTSW 1 153,341,452 (GRCm39) missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153,353,866 (GRCm39) missense probably benign 0.16
R4274:Dhx9 UTSW 1 153,344,672 (GRCm39) missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153,347,535 (GRCm39) missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153,342,903 (GRCm39) missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153,336,049 (GRCm39) missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153,342,797 (GRCm39) frame shift probably null
R4603:Dhx9 UTSW 1 153,342,797 (GRCm39) frame shift probably null
R4889:Dhx9 UTSW 1 153,356,895 (GRCm39) missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153,348,419 (GRCm39) missense probably benign 0.02
R5411:Dhx9 UTSW 1 153,356,969 (GRCm39) missense probably benign 0.27
R5569:Dhx9 UTSW 1 153,342,838 (GRCm39) missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153,359,493 (GRCm39) missense probably benign 0.44
R5659:Dhx9 UTSW 1 153,347,481 (GRCm39) missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153,353,835 (GRCm39) missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153,348,209 (GRCm39) missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153,332,324 (GRCm39) unclassified probably benign
R6489:Dhx9 UTSW 1 153,332,389 (GRCm39) unclassified probably benign
R6717:Dhx9 UTSW 1 153,349,210 (GRCm39) splice site probably null
R7098:Dhx9 UTSW 1 153,340,768 (GRCm39) missense probably benign
R7209:Dhx9 UTSW 1 153,340,369 (GRCm39) missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153,341,423 (GRCm39) missense probably benign 0.00
R7440:Dhx9 UTSW 1 153,356,977 (GRCm39) missense probably benign
R7685:Dhx9 UTSW 1 153,334,152 (GRCm39) missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153,340,747 (GRCm39) missense probably benign 0.07
R8088:Dhx9 UTSW 1 153,338,443 (GRCm39) missense probably benign 0.26
R8371:Dhx9 UTSW 1 153,331,961 (GRCm39) missense unknown
R8397:Dhx9 UTSW 1 153,344,657 (GRCm39) missense probably damaging 1.00
R8502:Dhx9 UTSW 1 153,335,210 (GRCm39) missense probably benign 0.01
R8519:Dhx9 UTSW 1 153,348,922 (GRCm39) missense probably damaging 1.00
R8531:Dhx9 UTSW 1 153,334,182 (GRCm39) missense possibly damaging 0.95
R8842:Dhx9 UTSW 1 153,338,335 (GRCm39) missense possibly damaging 0.91
R9145:Dhx9 UTSW 1 153,336,826 (GRCm39) missense probably damaging 1.00
R9295:Dhx9 UTSW 1 153,340,673 (GRCm39) missense probably damaging 0.98
R9557:Dhx9 UTSW 1 153,333,292 (GRCm39) missense probably benign 0.10
R9661:Dhx9 UTSW 1 153,340,393 (GRCm39) missense probably damaging 1.00
X0066:Dhx9 UTSW 1 153,348,275 (GRCm39) missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153,332,321 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGAACCACTCCCACTGCATTTTGTC -3'
(R):5'- TTAGCAGCACAGTCATGTGCCCTC -3'

Sequencing Primer
(F):5'- GGTTCAAAATGAGCCAATTTCCC -3'
(R):5'- AGGCTTACTCTGGGCTTACAAAG -3'
Posted On 2013-05-29