Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Rint1'

436804

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23810953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 406 (Y406H)

Ref Sequence

ENSEMBL: ENSMUSP00000110766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]

AlphaFold

Q8BZ36

Predicted Effect

probably damaging
Transcript: ENSMUST00000030852
AA Change: Y464H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: Y464H

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115113
AA Change: Y406H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: Y406H

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144709

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2070:Rint1	UTSW	5	23810929	missense	possibly damaging	0.94
R2920:Rint1	UTSW	5	23805402	missense	probably benign	0.00
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7634:Rint1	UTSW	5	23805479	missense	probably benign	0.00
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8791:Rint1	UTSW	5	23800596	missense	probably damaging	0.99
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8916:Rint1	UTSW	5	23787828	unclassified	probably benign
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACTATTGAGGGAGAATCAGGTATC -3'
(R):5'- CTGCCACAGATTTCTACTAGTGTAG -3'

Sequencing Primer
(F):5'- AGTATAGTGTGATTAGTTAGTGGGAG -3'
(R):5'- GACAGGGTCTCATATATCCCAGG -3'

Posted On

2016-10-24