Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Htt'

436805

Institutional Source

Beutler Lab

Gene Symbol

Htt

Ensembl Gene

ENSMUSG00000029104

Gene Name

huntingtin

Synonyms

HD, Hdh, htt, huntingtin, IT15

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34761740-34912534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34849075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1443 (Y1443H)

Ref Sequence

ENSEMBL: ENSMUSP00000078945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080036]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080036
AA Change: Y1443H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: Y1443H

Domain	Start	End	E-Value	Type
low complexity region	18	65	N/A	INTRINSIC
SCOP:d1qgra_	92	370	1e-12	SMART
low complexity region	371	388	N/A	INTRINSIC
low complexity region	432	453	N/A	INTRINSIC
low complexity region	1150	1161	N/A	INTRINSIC
low complexity region	1423	1441	N/A	INTRINSIC
Pfam:DUF3652	1494	1534	9.3e-20	PFAM
low complexity region	1812	1822	N/A	INTRINSIC
Blast:GAF	1866	2040	1e-104	BLAST
low complexity region	2461	2472	N/A	INTRINSIC
low complexity region	2611	2621	N/A	INTRINSIC
low complexity region	2622	2635	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Htt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Htt	APN	5	34799408	missense	probably benign	0.00
IGL00233:Htt	APN	5	34896026	splice site	probably null
IGL00559:Htt	APN	5	34849104	splice site	probably benign
IGL00765:Htt	APN	5	34877425	splice site	probably benign
IGL00950:Htt	APN	5	34891441	missense	probably benign
IGL00953:Htt	APN	5	34818677	missense	probably benign	0.04
IGL00957:Htt	APN	5	34806724	missense	probably benign
IGL01314:Htt	APN	5	34878856	missense	probably benign
IGL01412:Htt	APN	5	34898572	missense	probably damaging	0.98
IGL01510:Htt	APN	5	34907512	missense	probably damaging	1.00
IGL01617:Htt	APN	5	34876755	missense	possibly damaging	0.67
IGL01893:Htt	APN	5	34876830	missense	probably damaging	1.00
IGL01914:Htt	APN	5	34829709	missense	probably benign
IGL01994:Htt	APN	5	34832604	missense	possibly damaging	0.83
IGL02102:Htt	APN	5	34891481	splice site	probably benign
IGL02381:Htt	APN	5	34829760	missense	probably benign	0.03
IGL02529:Htt	APN	5	34819043	splice site	probably benign
IGL02678:Htt	APN	5	34899902	missense	probably damaging	1.00
IGL02707:Htt	APN	5	34829881	critical splice donor site	probably null
IGL02731:Htt	APN	5	34803793	missense	probably benign	0.41
IGL02931:Htt	APN	5	34876753	missense	probably damaging	1.00
IGL03167:Htt	APN	5	34818986	missense	probably damaging	0.98
IGL03343:Htt	APN	5	34826041	missense	probably benign
IGL03344:Htt	APN	5	34907466	missense	probably benign	0.02
IGL03344:Htt	APN	5	34879828	missense	probably benign	0.39
IGL03366:Htt	APN	5	34907580	missense	probably damaging	1.00
IGL03410:Htt	APN	5	34799445	missense	probably damaging	0.99
Chalk	UTSW	5	34907086	missense	possibly damaging	0.86
IGL02796:Htt	UTSW	5	34877482	missense	probably benign	0.43
PIT4377001:Htt	UTSW	5	34875965	missense	probably benign	0.10
R0013:Htt	UTSW	5	34820104	missense	probably benign	0.25
R0049:Htt	UTSW	5	34908662	missense	probably damaging	0.97
R0049:Htt	UTSW	5	34908662	missense	probably damaging	0.97
R0056:Htt	UTSW	5	34826078	splice site	probably benign
R0207:Htt	UTSW	5	34896908	missense	probably benign	0.11
R0329:Htt	UTSW	5	34817134	splice site	probably benign
R0494:Htt	UTSW	5	34821844	missense	possibly damaging	0.73
R0548:Htt	UTSW	5	34870746	missense	probably damaging	1.00
R0601:Htt	UTSW	5	34846003	missense	probably benign	0.08
R0799:Htt	UTSW	5	34817753	missense	probably benign	0.00
R0947:Htt	UTSW	5	34898924	missense	probably damaging	1.00
R1053:Htt	UTSW	5	34851217	critical splice acceptor site	probably null
R1147:Htt	UTSW	5	34851252	missense	probably damaging	0.98
R1147:Htt	UTSW	5	34851252	missense	probably damaging	0.98
R1478:Htt	UTSW	5	34803827	missense	probably damaging	0.99
R1573:Htt	UTSW	5	34864374	splice site	probably benign
R1677:Htt	UTSW	5	34828574	missense	probably damaging	1.00
R1792:Htt	UTSW	5	34907199	missense	probably damaging	1.00
R1816:Htt	UTSW	5	34803740	missense	probably benign	0.01
R1833:Htt	UTSW	5	34905748	splice site	probably benign
R1837:Htt	UTSW	5	34819023	missense	probably benign	0.00
R1846:Htt	UTSW	5	34848944	missense	probably damaging	0.98
R1875:Htt	UTSW	5	34794112	missense	probably benign	0.05
R1899:Htt	UTSW	5	34907085	missense	probably benign	0.01
R2013:Htt	UTSW	5	34852871	missense	probably damaging	0.99
R2062:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2064:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2067:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2068:Htt	UTSW	5	34825982	missense	probably benign	0.00
R2131:Htt	UTSW	5	34877109	missense	possibly damaging	0.50
R2162:Htt	UTSW	5	34821718	missense	probably benign	0.44
R2169:Htt	UTSW	5	34877475	missense	probably benign	0.08
R2345:Htt	UTSW	5	34826004	missense	possibly damaging	0.80
R2433:Htt	UTSW	5	34907541	missense	possibly damaging	0.65
R3027:Htt	UTSW	5	34820095	missense	possibly damaging	0.85
R3123:Htt	UTSW	5	34804531	missense	probably benign
R3125:Htt	UTSW	5	34804531	missense	probably benign
R3717:Htt	UTSW	5	34811522	splice site	probably benign
R3758:Htt	UTSW	5	34895970	missense	probably damaging	0.97
R3805:Htt	UTSW	5	34877204	splice site	probably null
R3833:Htt	UTSW	5	34821718	missense	probably benign	0.44
R4066:Htt	UTSW	5	34878847	missense	probably benign
R4272:Htt	UTSW	5	34849069	missense	possibly damaging	0.96
R4625:Htt	UTSW	5	34829785	missense	probably damaging	0.99
R4634:Htt	UTSW	5	34875948	missense	probably benign	0.06
R4655:Htt	UTSW	5	34906132	missense	probably benign	0.06
R4679:Htt	UTSW	5	34820080	missense	probably benign
R4684:Htt	UTSW	5	34852765	missense	probably damaging	1.00
R4832:Htt	UTSW	5	34824840	missense	probably benign	0.01
R4833:Htt	UTSW	5	34852225	missense	probably damaging	0.98
R4973:Htt	UTSW	5	34813023	missense	probably damaging	0.99
R5095:Htt	UTSW	5	34824395	missense	possibly damaging	0.89
R5132:Htt	UTSW	5	34905679	missense	possibly damaging	0.89
R5351:Htt	UTSW	5	34803833	missense	probably damaging	0.99
R5361:Htt	UTSW	5	34907584	missense	possibly damaging	0.47
R5399:Htt	UTSW	5	34877151	missense	probably damaging	0.98
R5462:Htt	UTSW	5	34885507	nonsense	probably null
R5552:Htt	UTSW	5	34821774	missense	probably benign
R5595:Htt	UTSW	5	34905397	missense	probably damaging	0.96
R5617:Htt	UTSW	5	34870806	missense	possibly damaging	0.77
R5835:Htt	UTSW	5	34813190	missense	probably benign	0.16
R5891:Htt	UTSW	5	34870823	missense	possibly damaging	0.62
R6158:Htt	UTSW	5	34907086	missense	possibly damaging	0.86
R6159:Htt	UTSW	5	34804676	missense	probably benign	0.08
R6169:Htt	UTSW	5	34907473	missense	probably damaging	1.00
R6242:Htt	UTSW	5	34846012	missense	probably damaging	1.00
R6274:Htt	UTSW	5	34852087	missense	possibly damaging	0.81
R6280:Htt	UTSW	5	34870759	missense	probably benign	0.00
R6294:Htt	UTSW	5	34821826	missense	probably benign
R6331:Htt	UTSW	5	34895887	missense	possibly damaging	0.89
R6448:Htt	UTSW	5	34875992	missense	probably benign	0.05
R6474:Htt	UTSW	5	34824895	missense	probably benign	0.06
R6592:Htt	UTSW	5	34877044	missense	possibly damaging	0.92
R6818:Htt	UTSW	5	34782767	missense	probably damaging	0.99
R6830:Htt	UTSW	5	34834326	missense	possibly damaging	0.82
R6920:Htt	UTSW	5	34877100	missense	probably null	1.00
R6962:Htt	UTSW	5	34899771	critical splice acceptor site	probably null
R7057:Htt	UTSW	5	34821723	missense	probably null	0.05
R7144:Htt	UTSW	5	34846006	missense	probably damaging	1.00
R7166:Htt	UTSW	5	34852894	missense	probably benign	0.42
R7329:Htt	UTSW	5	34829755	missense	probably benign	0.03
R7378:Htt	UTSW	5	34803799	missense	probably benign	0.04
R7418:Htt	UTSW	5	34790353	missense	possibly damaging	0.55
R7495:Htt	UTSW	5	34811477	missense	probably benign	0.00
R7554:Htt	UTSW	5	34864740	missense	probably damaging	0.97
R7575:Htt	UTSW	5	34905643	missense	probably damaging	1.00
R7763:Htt	UTSW	5	34852190	missense	probably damaging	1.00
R7782:Htt	UTSW	5	34882992	missense	probably benign	0.03
R7850:Htt	UTSW	5	34852287	splice site	probably null
R7870:Htt	UTSW	5	34898547	missense	possibly damaging	0.77
R7871:Htt	UTSW	5	34864649	missense	probably benign	0.00
R7879:Htt	UTSW	5	34823908	missense	probably benign
R7992:Htt	UTSW	5	34829881	critical splice donor site	probably null
R8058:Htt	UTSW	5	34820100	missense	probably benign
R8168:Htt	UTSW	5	34882956	missense	probably benign	0.00
R8188:Htt	UTSW	5	34761943	missense	probably benign	0.03
R8262:Htt	UTSW	5	34895960	missense	probably benign
R8343:Htt	UTSW	5	34905724	missense	probably damaging	1.00
R8353:Htt	UTSW	5	34877155	missense	possibly damaging	0.49
R8769:Htt	UTSW	5	34820289	missense	probably benign	0.05
R8808:Htt	UTSW	5	34889447	missense	probably benign	0.10
R8825:Htt	UTSW	5	34825960	missense	probably benign	0.24
R8843:Htt	UTSW	5	34889465	missense	possibly damaging	0.92
R8856:Htt	UTSW	5	34903331	missense	probably benign	0.44
R8882:Htt	UTSW	5	34821717	missense	probably benign
R8898:Htt	UTSW	5	34819032	missense	probably benign	0.01
R8964:Htt	UTSW	5	34905376	missense	probably benign	0.09
R8987:Htt	UTSW	5	34820024	missense	probably benign	0.18
R8991:Htt	UTSW	5	34905718	missense	probably damaging	1.00
R9005:Htt	UTSW	5	34817751	missense	possibly damaging	0.92
R9019:Htt	UTSW	5	34866576	missense	probably damaging	1.00
R9057:Htt	UTSW	5	34852110	missense	possibly damaging	0.86
R9157:Htt	UTSW	5	34829827	missense	probably null	0.89
R9205:Htt	UTSW	5	34819023	missense	probably benign	0.00
R9223:Htt	UTSW	5	34905348	missense	probably benign	0.01
R9243:Htt	UTSW	5	34898932	splice site	probably benign
R9329:Htt	UTSW	5	34832613	missense	possibly damaging	0.69
R9355:Htt	UTSW	5	34895903	missense	probably benign
R9402:Htt	UTSW	5	34848980	missense	probably damaging	1.00
R9446:Htt	UTSW	5	34761928	missense	probably benign
R9716:Htt	UTSW	5	34854675	missense	probably damaging	1.00
Z1177:Htt	UTSW	5	34852231	missense	probably null	0.87

Predicted Primers

PCR Primer
(F):5'- CAGAAGATTCTAATTGCAACTGTGG -3'
(R):5'- TTGCATAAATGACCTGGCCC -3'

Sequencing Primer
(F):5'- AATTGCAACTGTGGTTTCTTTCAC -3'
(R):5'- GGCCCACCAGAATAAATCTAAAATTC -3'

Posted On

2016-10-24