Incidental Mutation 'R5566:Htt'
ID436805
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34849075 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1443 (Y1443H)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably damaging
Transcript: ENSMUST00000080036
AA Change: Y1443H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: Y1443H

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2068:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4684:Htt UTSW 5 34852765 missense probably damaging 1.00
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6169:Htt UTSW 5 34907473 missense probably damaging 1.00
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7166:Htt UTSW 5 34852894 missense probably benign 0.42
R7329:Htt UTSW 5 34829755 missense probably benign 0.03
R7378:Htt UTSW 5 34803799 missense probably benign 0.04
R7418:Htt UTSW 5 34790353 missense possibly damaging 0.55
R7495:Htt UTSW 5 34811477 missense probably benign 0.00
R7554:Htt UTSW 5 34864740 missense probably damaging 0.97
R7575:Htt UTSW 5 34905643 missense probably damaging 1.00
R7763:Htt UTSW 5 34852190 missense probably damaging 1.00
R7782:Htt UTSW 5 34882992 missense probably benign 0.03
R7870:Htt UTSW 5 34898547 missense possibly damaging 0.77
R7871:Htt UTSW 5 34864649 missense probably benign 0.00
R7879:Htt UTSW 5 34823908 missense probably benign
R7933:Htt UTSW 5 34852287 intron probably null
R7953:Htt UTSW 5 34898547 missense possibly damaging 0.77
R7954:Htt UTSW 5 34864649 missense probably benign 0.00
R7962:Htt UTSW 5 34823908 missense probably benign
R8058:Htt UTSW 5 34820100 missense probably benign
Z1177:Htt UTSW 5 34852231 missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- CAGAAGATTCTAATTGCAACTGTGG -3'
(R):5'- TTGCATAAATGACCTGGCCC -3'

Sequencing Primer
(F):5'- AATTGCAACTGTGGTTTCTTTCAC -3'
(R):5'- GGCCCACCAGAATAAATCTAAAATTC -3'
Posted On2016-10-24