Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Cnga1'

436806

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

043123-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72618250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 43 (N43Y)

Ref Sequence

ENSEMBL: ENSMUSP00000143377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000135701] [ENSMUST00000169997] [ENSMUST00000201463]

AlphaFold

P29974

Predicted Effect

probably benign
Transcript: ENSMUST00000087213
AA Change: N43Y

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: N43Y

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000126799
AA Change: N43Y

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000135701

Predicted Effect

probably benign
Transcript: ENSMUST00000169997
AA Change: N43Y

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: N43Y

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000201463
AA Change: N43Y

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: N43Y

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
tintoretto	UTSW	5	72609500	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
R7922:Cnga1	UTSW	5	72604882	missense	possibly damaging	0.81
R7938:Cnga1	UTSW	5	72604254	missense	probably benign	0.27
R7994:Cnga1	UTSW	5	72604660	missense	probably damaging	1.00
R8249:Cnga1	UTSW	5	72605394	missense	probably benign	0.02
R8690:Cnga1	UTSW	5	72604492	missense	probably benign	0.15
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00
Z1177:Cnga1	UTSW	5	72605530	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGATATTTCGGTGGCAAGAGC -3'
(R):5'- CTGGGCACACTCTGTATAGAATG -3'

Sequencing Primer
(F):5'- TCGGTGGCAAGAGCACTGG -3'
(R):5'- AGAATGCTATACTTGTACCTCACTC -3'

Posted On

2016-10-24