Incidental Mutation 'R5566:Rest'
ID436807
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene NameRE1-silencing transcription factor
SynonymsNRSF, 2610008J04Rik
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77265491-77286432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77282326 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 864 (E864G)
Ref Sequence ENSEMBL: ENSMUSP00000109076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
Predicted Effect probably benign
Transcript: ENSMUST00000080359
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: E864G

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113449
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: E864G

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77275288 missense probably damaging 1.00
pace UTSW 5 77275243 missense possibly damaging 0.94
ruhe UTSW 5 77268362 missense possibly damaging 0.71
R0027:Rest UTSW 5 77282551 missense probably benign
R0479:Rest UTSW 5 77282751 missense probably damaging 0.99
R0526:Rest UTSW 5 77281027 missense probably damaging 0.98
R1865:Rest UTSW 5 77280898 missense probably damaging 1.00
R1869:Rest UTSW 5 77268362 missense possibly damaging 0.71
R1870:Rest UTSW 5 77268362 missense possibly damaging 0.71
R2089:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2347:Rest UTSW 5 77268593 missense probably damaging 1.00
R2366:Rest UTSW 5 77268187 missense probably benign 0.00
R3609:Rest UTSW 5 77282800 missense probably benign 0.06
R4249:Rest UTSW 5 77282112 missense probably benign
R4471:Rest UTSW 5 77281180 missense probably benign 0.01
R4472:Rest UTSW 5 77281180 missense probably benign 0.01
R4685:Rest UTSW 5 77275243 missense possibly damaging 0.94
R5175:Rest UTSW 5 77268372 missense probably damaging 1.00
R5686:Rest UTSW 5 77281726 missense probably benign 0.01
R5976:Rest UTSW 5 77268272 missense probably benign 0.07
R6052:Rest UTSW 5 77281180 missense probably benign 0.34
R6076:Rest UTSW 5 77282974 missense unknown
R6249:Rest UTSW 5 77281224 missense probably benign 0.01
R6448:Rest UTSW 5 77281471 missense possibly damaging 0.75
R6681:Rest UTSW 5 77280997 missense probably damaging 1.00
R6974:Rest UTSW 5 77268199 missense probably damaging 1.00
R7185:Rest UTSW 5 77282484 missense probably benign
R7216:Rest UTSW 5 77282608 missense probably benign 0.04
R7355:Rest UTSW 5 77268028 missense probably benign 0.23
R7360:Rest UTSW 5 77281129 missense probably benign 0.36
R7705:Rest UTSW 5 77268272 missense probably damaging 1.00
R8052:Rest UTSW 5 77268324 missense probably benign 0.04
R8220:Rest UTSW 5 77282478 missense probably benign
R8441:Rest UTSW 5 77281919 missense possibly damaging 0.95
Z1177:Rest UTSW 5 77280909 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTCCGGAAAGACAGAGCAG -3'
(R):5'- AGTGTCCACGTCACAAAGCC -3'

Sequencing Primer
(F):5'- CAGAGAAGGAGCTGAGCCTGC -3'
(R):5'- AGGAGCCAGTCTGACACTTG -3'
Posted On2016-10-24