Incidental Mutation 'R5566:Rest'
ID 436807
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene Name RE1-silencing transcription factor
Synonyms NRSF, 2610008J04Rik
MMRRC Submission 043123-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5566 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 77265491-77286432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77282326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 864 (E864G)
Ref Sequence ENSEMBL: ENSMUSP00000109076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
AlphaFold Q8VIG1
Predicted Effect probably benign
Transcript: ENSMUST00000080359
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: E864G

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113449
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: E864G

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,615 (GRCm38) Y2159* probably null Het
Abca3 A G 17: 24,383,927 (GRCm38) T499A probably benign Het
Abcb5 T A 12: 118,935,967 (GRCm38) T322S probably damaging Het
Adamts4 T A 1: 171,250,850 (GRCm38) M1K probably null Het
Adamtsl4 C T 3: 95,685,455 (GRCm38) probably null Het
Adh4 A T 3: 138,424,189 (GRCm38) I259F probably damaging Het
Aff3 G A 1: 38,181,424 (GRCm38) S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 (GRCm38) D280G probably benign Het
Baiap3 T C 17: 25,251,733 (GRCm38) E71G probably damaging Het
Calb2 A G 8: 110,152,700 (GRCm38) I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 (GRCm38) N100S probably benign Het
Cep57 G T 9: 13,821,575 (GRCm38) R25S probably damaging Het
Chadl A G 15: 81,695,878 (GRCm38) L52P probably damaging Het
Clec12b T C 6: 129,385,475 (GRCm38) T6A probably damaging Het
Cnga1 T A 5: 72,618,250 (GRCm38) N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 (GRCm38) probably null Het
Csmd2 T C 4: 128,462,889 (GRCm38) probably null Het
Ctps1 A T 4: 120,554,103 (GRCm38) probably null Het
Cyp39a1 T A 17: 43,685,208 (GRCm38) W224R possibly damaging Het
Defb29 A T 2: 152,538,928 (GRCm38) Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 (GRCm38) D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 (GRCm38) I2671K probably benign Het
Dnah2 C A 11: 69,516,569 (GRCm38) E158* probably null Het
Dynlt2b A G 16: 32,419,900 (GRCm38) Y31C probably damaging Het
Edar A G 10: 58,628,641 (GRCm38) S59P possibly damaging Het
Egr2 T A 10: 67,540,766 (GRCm38) C339* probably null Het
Eif5b G A 1: 38,045,684 (GRCm38) V871I possibly damaging Het
Eif5b G A 1: 38,051,247 (GRCm38) G1169E probably damaging Het
Erap1 A G 13: 74,662,412 (GRCm38) Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 (GRCm38) T790S possibly damaging Het
Fkrp C T 7: 16,810,924 (GRCm38) V338M probably damaging Het
Gabra6 T C 11: 42,307,490 (GRCm38) T378A probably benign Het
Gm4924 C A 10: 82,378,641 (GRCm38) Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 (GRCm38) noncoding transcript Het
Gpr108 A G 17: 57,236,919 (GRCm38) F429S probably damaging Het
Gpr162 G A 6: 124,860,938 (GRCm38) R250* probably null Het
Gtf2a1 A T 12: 91,567,594 (GRCm38) D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 (GRCm38) T121I probably benign Het
Herc1 T A 9: 66,465,537 (GRCm38) M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 (GRCm38) Y167* probably null Het
Hrob T A 11: 102,255,833 (GRCm38) S312T probably damaging Het
Htt T C 5: 34,849,075 (GRCm38) Y1443H probably damaging Het
Il21r A G 7: 125,625,298 (GRCm38) D28G probably damaging Het
Impact T G 18: 12,974,762 (GRCm38) V29G probably damaging Het
Itpr3 A G 17: 27,115,952 (GRCm38) T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 (GRCm38) L50Q probably damaging Het
Jade1 A G 3: 41,604,903 (GRCm38) D473G possibly damaging Het
Kif26a T G 12: 112,157,354 (GRCm38) L131R probably damaging Het
Kif2a A T 13: 106,993,924 (GRCm38) M1K probably null Het
Lrsam1 C A 2: 32,941,858 (GRCm38) Q368H probably damaging Het
Macf1 T C 4: 123,435,164 (GRCm38) Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 (GRCm38) V893A probably damaging Het
Med13l G T 5: 118,728,665 (GRCm38) V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 (GRCm38) L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 (GRCm38) L471P probably damaging Het
Myo7a T C 7: 98,064,816 (GRCm38) E1616G possibly damaging Het
Nacad T A 11: 6,602,136 (GRCm38) S352C probably damaging Het
Nfat5 T A 8: 107,369,135 (GRCm38) M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 (GRCm38) L668F probably damaging Het
Or12j2 C A 7: 140,336,067 (GRCm38) D68E probably damaging Het
Or7e178 T C 9: 20,313,969 (GRCm38) Q309R probably benign Het
Or8j3c G A 2: 86,423,377 (GRCm38) Q100* probably null Het
Plxnb2 T C 15: 89,164,020 (GRCm38) T696A probably benign Het
Prkab2 T A 3: 97,662,293 (GRCm38) F58L probably benign Het
Prpf4 G T 4: 62,415,969 (GRCm38) L220F probably benign Het
Rad18 A T 6: 112,681,346 (GRCm38) D199E probably benign Het
Raet1e T C 10: 22,174,405 (GRCm38) L29P probably damaging Het
Ralgapb A C 2: 158,494,710 (GRCm38) T1089P possibly damaging Het
Rgsl1 T A 1: 153,793,774 (GRCm38) I289F probably damaging Het
Rint1 T C 5: 23,810,953 (GRCm38) Y406H probably damaging Het
Rmc1 T C 18: 12,180,692 (GRCm38) I26T possibly damaging Het
Rpl31 C T 1: 39,370,027 (GRCm38) R41C probably benign Het
Scn8a T C 15: 100,974,534 (GRCm38) S485P probably damaging Het
Slamf1 T A 1: 171,787,970 (GRCm38) V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 (GRCm38) T362I possibly damaging Het
Sos1 C T 17: 80,453,890 (GRCm38) V126I possibly damaging Het
Srcap T C 7: 127,525,303 (GRCm38) F215S probably damaging Het
Supt4a T A 11: 87,743,287 (GRCm38) S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 (GRCm38) T232S probably damaging Het
Tenm3 A G 8: 48,279,006 (GRCm38) C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 (GRCm38) L100* probably null Het
Tgm1 C A 14: 55,712,436 (GRCm38) R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 (GRCm38) T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 (GRCm38) T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 (GRCm38) F320I possibly damaging Het
Tut7 A T 13: 59,788,629 (GRCm38) C817* probably null Het
Vmn1r21 A C 6: 57,844,094 (GRCm38) Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 (GRCm38) D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 (GRCm38) L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 (GRCm38) I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 (GRCm38) Y564N probably damaging Het
Wee1 G T 7: 110,126,050 (GRCm38) E300* probably null Het
Xdh T C 17: 73,893,622 (GRCm38) D1168G probably damaging Het
Zfp54 A G 17: 21,433,444 (GRCm38) T67A probably damaging Het
Zfp941 G T 7: 140,812,766 (GRCm38) H227N probably benign Het
Zpr1 T A 9: 46,281,075 (GRCm38) V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 (GRCm38) E285G probably damaging Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77,275,288 (GRCm38) missense probably damaging 1.00
pace UTSW 5 77,275,243 (GRCm38) missense possibly damaging 0.94
ruhe UTSW 5 77,268,362 (GRCm38) missense possibly damaging 0.71
R0027:Rest UTSW 5 77,282,551 (GRCm38) missense probably benign
R0479:Rest UTSW 5 77,282,751 (GRCm38) missense probably damaging 0.99
R0526:Rest UTSW 5 77,281,027 (GRCm38) missense probably damaging 0.98
R1865:Rest UTSW 5 77,280,898 (GRCm38) missense probably damaging 1.00
R1869:Rest UTSW 5 77,268,362 (GRCm38) missense possibly damaging 0.71
R1870:Rest UTSW 5 77,268,362 (GRCm38) missense possibly damaging 0.71
R2089:Rest UTSW 5 77,281,279 (GRCm38) missense possibly damaging 0.92
R2091:Rest UTSW 5 77,281,279 (GRCm38) missense possibly damaging 0.92
R2091:Rest UTSW 5 77,281,279 (GRCm38) missense possibly damaging 0.92
R2347:Rest UTSW 5 77,268,593 (GRCm38) missense probably damaging 1.00
R2366:Rest UTSW 5 77,268,187 (GRCm38) missense probably benign 0.00
R3609:Rest UTSW 5 77,282,800 (GRCm38) missense probably benign 0.06
R4249:Rest UTSW 5 77,282,112 (GRCm38) missense probably benign
R4471:Rest UTSW 5 77,281,180 (GRCm38) missense probably benign 0.01
R4472:Rest UTSW 5 77,281,180 (GRCm38) missense probably benign 0.01
R4685:Rest UTSW 5 77,275,243 (GRCm38) missense possibly damaging 0.94
R5175:Rest UTSW 5 77,268,372 (GRCm38) missense probably damaging 1.00
R5686:Rest UTSW 5 77,281,726 (GRCm38) missense probably benign 0.01
R5976:Rest UTSW 5 77,268,272 (GRCm38) missense probably benign 0.07
R6052:Rest UTSW 5 77,281,180 (GRCm38) missense probably benign 0.34
R6076:Rest UTSW 5 77,282,974 (GRCm38) missense unknown
R6249:Rest UTSW 5 77,281,224 (GRCm38) missense probably benign 0.01
R6448:Rest UTSW 5 77,281,471 (GRCm38) missense possibly damaging 0.75
R6681:Rest UTSW 5 77,280,997 (GRCm38) missense probably damaging 1.00
R6974:Rest UTSW 5 77,268,199 (GRCm38) missense probably damaging 1.00
R7185:Rest UTSW 5 77,282,484 (GRCm38) missense probably benign
R7216:Rest UTSW 5 77,282,608 (GRCm38) missense probably benign 0.04
R7355:Rest UTSW 5 77,268,028 (GRCm38) missense probably benign 0.23
R7360:Rest UTSW 5 77,281,129 (GRCm38) missense probably benign 0.36
R7705:Rest UTSW 5 77,268,272 (GRCm38) missense probably damaging 1.00
R8052:Rest UTSW 5 77,268,324 (GRCm38) missense probably benign 0.04
R8220:Rest UTSW 5 77,282,478 (GRCm38) missense probably benign
R8441:Rest UTSW 5 77,281,919 (GRCm38) missense possibly damaging 0.95
R8699:Rest UTSW 5 77,281,542 (GRCm38) missense probably benign 0.04
R8879:Rest UTSW 5 77,282,511 (GRCm38) missense probably benign 0.00
R8940:Rest UTSW 5 77,282,868 (GRCm38) missense possibly damaging 0.91
R8961:Rest UTSW 5 77,268,635 (GRCm38) missense probably damaging 1.00
R9165:Rest UTSW 5 77,281,804 (GRCm38) small deletion probably benign
R9167:Rest UTSW 5 77,281,804 (GRCm38) small deletion probably benign
R9168:Rest UTSW 5 77,281,804 (GRCm38) small deletion probably benign
R9170:Rest UTSW 5 77,281,804 (GRCm38) small deletion probably benign
R9377:Rest UTSW 5 77,268,281 (GRCm38) missense possibly damaging 0.47
R9476:Rest UTSW 5 77,268,251 (GRCm38) missense probably damaging 0.99
R9566:Rest UTSW 5 77,268,430 (GRCm38) nonsense probably null
R9596:Rest UTSW 5 77,275,294 (GRCm38) missense probably damaging 1.00
Z1177:Rest UTSW 5 77,280,909 (GRCm38) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTCCGGAAAGACAGAGCAG -3'
(R):5'- AGTGTCCACGTCACAAAGCC -3'

Sequencing Primer
(F):5'- CAGAGAAGGAGCTGAGCCTGC -3'
(R):5'- AGGAGCCAGTCTGACACTTG -3'
Posted On 2016-10-24