Mutagenetix > Incidental Mutations

Incidental Mutation 'R5566:Rest'

436807

Institutional Source

Beutler Lab

Gene Symbol

Rest

Ensembl Gene

ENSMUSG00000029249

Gene Name

RE1-silencing transcription factor

Synonyms

NRSF, 2610008J04Rik

MMRRC Submission

043123-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77265491-77286432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77282326 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 864 (E864G)

Ref Sequence

ENSEMBL: ENSMUSP00000109076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]

Predicted Effect

probably benign
Transcript: ENSMUST00000080359
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: E864G

Domain	Start	End	E-Value	Type
low complexity region	85	95	N/A	INTRINSIC
ZnF_C2H2	154	176	1.53e-1	SMART
ZnF_C2H2	211	233	4.23e0	SMART
ZnF_C2H2	243	265	2.53e-2	SMART
ZnF_C2H2	271	293	8.34e-3	SMART
ZnF_C2H2	299	321	2.12e-4	SMART
ZnF_C2H2	327	350	1.18e-2	SMART
ZnF_C2H2	356	378	1.03e-2	SMART
ZnF_C2H2	384	407	2.53e-2	SMART
low complexity region	419	427	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC
low complexity region	492	505	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
low complexity region	544	554	N/A	INTRINSIC
low complexity region	578	599	N/A	INTRINSIC
low complexity region	681	715	N/A	INTRINSIC
low complexity region	725	744	N/A	INTRINSIC
low complexity region	771	793	N/A	INTRINSIC
low complexity region	843	851	N/A	INTRINSIC
low complexity region	880	895	N/A	INTRINSIC
ZnF_C2H2	1036	1058	2.2e-2	SMART
coiled coil region	1060	1082	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113449
AA Change: E864G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: E864G

Domain	Start	End	E-Value	Type
low complexity region	85	95	N/A	INTRINSIC
ZnF_C2H2	154	176	1.53e-1	SMART
ZnF_C2H2	211	233	4.23e0	SMART
ZnF_C2H2	243	265	2.53e-2	SMART
ZnF_C2H2	271	293	8.34e-3	SMART
ZnF_C2H2	299	321	2.12e-4	SMART
ZnF_C2H2	327	350	1.18e-2	SMART
ZnF_C2H2	356	378	1.03e-2	SMART
ZnF_C2H2	384	407	2.53e-2	SMART
low complexity region	419	427	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC
low complexity region	492	505	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC
low complexity region	544	554	N/A	INTRINSIC
low complexity region	578	599	N/A	INTRINSIC
low complexity region	681	715	N/A	INTRINSIC
low complexity region	725	744	N/A	INTRINSIC
low complexity region	771	793	N/A	INTRINSIC
low complexity region	843	851	N/A	INTRINSIC
low complexity region	880	895	N/A	INTRINSIC
ZnF_C2H2	1036	1058	2.2e-2	SMART
coiled coil region	1060	1082	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Rest

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02339:Rest	APN	5	77275288	missense	probably damaging	1.00
pace	UTSW	5	77275243	missense	possibly damaging	0.94
ruhe	UTSW	5	77268362	missense	possibly damaging	0.71
R0027:Rest	UTSW	5	77282551	missense	probably benign
R0479:Rest	UTSW	5	77282751	missense	probably damaging	0.99
R0526:Rest	UTSW	5	77281027	missense	probably damaging	0.98
R1865:Rest	UTSW	5	77280898	missense	probably damaging	1.00
R1869:Rest	UTSW	5	77268362	missense	possibly damaging	0.71
R1870:Rest	UTSW	5	77268362	missense	possibly damaging	0.71
R2089:Rest	UTSW	5	77281279	missense	possibly damaging	0.92
R2091:Rest	UTSW	5	77281279	missense	possibly damaging	0.92
R2091:Rest	UTSW	5	77281279	missense	possibly damaging	0.92
R2347:Rest	UTSW	5	77268593	missense	probably damaging	1.00
R2366:Rest	UTSW	5	77268187	missense	probably benign	0.00
R3609:Rest	UTSW	5	77282800	missense	probably benign	0.06
R4249:Rest	UTSW	5	77282112	missense	probably benign
R4471:Rest	UTSW	5	77281180	missense	probably benign	0.01
R4472:Rest	UTSW	5	77281180	missense	probably benign	0.01
R4685:Rest	UTSW	5	77275243	missense	possibly damaging	0.94
R5175:Rest	UTSW	5	77268372	missense	probably damaging	1.00
R5686:Rest	UTSW	5	77281726	missense	probably benign	0.01
R5976:Rest	UTSW	5	77268272	missense	probably benign	0.07
R6052:Rest	UTSW	5	77281180	missense	probably benign	0.34
R6076:Rest	UTSW	5	77282974	missense	unknown
R6249:Rest	UTSW	5	77281224	missense	probably benign	0.01
R6448:Rest	UTSW	5	77281471	missense	possibly damaging	0.75
R6681:Rest	UTSW	5	77280997	missense	probably damaging	1.00
R6974:Rest	UTSW	5	77268199	missense	probably damaging	1.00
R7185:Rest	UTSW	5	77282484	missense	probably benign
R7216:Rest	UTSW	5	77282608	missense	probably benign	0.04
R7355:Rest	UTSW	5	77268028	missense	probably benign	0.23
R7360:Rest	UTSW	5	77281129	missense	probably benign	0.36
R7705:Rest	UTSW	5	77268272	missense	probably damaging	1.00
R8052:Rest	UTSW	5	77268324	missense	probably benign	0.04
R8220:Rest	UTSW	5	77282478	missense	probably benign
R8441:Rest	UTSW	5	77281919	missense	possibly damaging	0.95
Z1177:Rest	UTSW	5	77280909	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TCTCCGGAAAGACAGAGCAG -3'
(R):5'- AGTGTCCACGTCACAAAGCC -3'

Sequencing Primer
(F):5'- CAGAGAAGGAGCTGAGCCTGC -3'
(R):5'- AGGAGCCAGTCTGACACTTG -3'

Posted On

2016-10-24