Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Dmbt1'

436824

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131032053-131121630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 131106273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1241 (D1241V)

Ref Sequence

ENSEMBL: ENSMUSP00000148657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084509
AA Change: D1404V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: D1404V

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208311
AA Change: D1415V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213064
AA Change: D1241V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	131079540	intron	probably benign
IGL00161:Dmbt1	APN	7	131109628	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	131099290	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	131082500	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	131097607	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	131058158	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	131085368	splice site	probably benign
IGL01317:Dmbt1	APN	7	131041191	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	131088767	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	131103679	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	131116728	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	131081185	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	131074419	intron	probably benign
IGL02160:Dmbt1	APN	7	131082688	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	131093256	splice site	probably benign
IGL02197:Dmbt1	APN	7	131085422	splice site	probably benign
IGL02332:Dmbt1	APN	7	131066613	intron	probably benign
IGL02427:Dmbt1	APN	7	131088085	splice site	probably null
IGL02726:Dmbt1	APN	7	131074410	intron	probably benign
IGL02967:Dmbt1	APN	7	131071189	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	131082679	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	131111049	missense	probably damaging	0.99
cavity	UTSW	7	131112236	missense	unknown
lacunar	UTSW	7	131097631	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	131112076	nonsense	probably null
K3955:Dmbt1	UTSW	7	131119564	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	131106393	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	131096049	splice site	probably benign
R0427:Dmbt1	UTSW	7	131040902	nonsense	probably null
R0478:Dmbt1	UTSW	7	131041187	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	131097673	splice site	probably null
R0538:Dmbt1	UTSW	7	131049901	splice site	probably benign
R0626:Dmbt1	UTSW	7	131102081	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	131097653	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	131093117	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	131074524	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	131050214	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	131044487	splice site	probably benign
R1463:Dmbt1	UTSW	7	131109637	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	131074331	intron	probably benign
R1990:Dmbt1	UTSW	7	131058288	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	131106359	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	131099133	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	131050018	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	131102032	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	131097575	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	131046562	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	131090494	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	131106468	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	131094734	nonsense	probably null
R3014:Dmbt1	UTSW	7	131032097	intron	probably benign
R3155:Dmbt1	UTSW	7	131050157	nonsense	probably null
R3176:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	131106249	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	131112090	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	131074202	intron	probably benign
R4396:Dmbt1	UTSW	7	131116632	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	131040934	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	131050012	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	131094742	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	131097670	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	131094735	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	131082619	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	131041021	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	131119511	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	131040993	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	131063403	intron	probably benign
R5526:Dmbt1	UTSW	7	131041190	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	131099300	nonsense	probably null
R5595:Dmbt1	UTSW	7	131054067	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	131109641	splice site	probably null
R6188:Dmbt1	UTSW	7	131097631	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	131058254	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	131103578	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	131116641	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	131046510	splice site	probably null
R6719:Dmbt1	UTSW	7	131119603	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	131046561	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	131066734	nonsense	probably null
R7191:Dmbt1	UTSW	7	131044520	missense	unknown
R7269:Dmbt1	UTSW	7	131066621	missense	unknown
R7288:Dmbt1	UTSW	7	131083789	nonsense	probably null
R7296:Dmbt1	UTSW	7	131112132	missense	unknown
R7349:Dmbt1	UTSW	7	131041124	missense	unknown
R7386:Dmbt1	UTSW	7	131112236	missense	unknown
R7428:Dmbt1	UTSW	7	131108463	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	131079511	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	131066462	missense	unknown
R7513:Dmbt1	UTSW	7	131090512	missense	unknown
R7553:Dmbt1	UTSW	7	131104867	missense	unknown
R7567:Dmbt1	UTSW	7	131061363	splice site	probably null
R7584:Dmbt1	UTSW	7	131088751	nonsense	probably null
R7736:Dmbt1	UTSW	7	131116896	missense	unknown
R7758:Dmbt1	UTSW	7	131121197	missense	unknown
R7928:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	131088770	missense	unknown
R8098:Dmbt1	UTSW	7	131108459	nonsense	probably null
R8125:Dmbt1	UTSW	7	131099223	missense	unknown
R8177:Dmbt1	UTSW	7	131106432	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	131066600	missense	unknown
R8378:Dmbt1	UTSW	7	131106465	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	131082587	missense	unknown
R8400:Dmbt1	UTSW	7	131082587	missense	unknown
R8445:Dmbt1	UTSW	7	131090380	missense	unknown
R8450:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	131102012	missense	unknown
R8688:Dmbt1	UTSW	7	131058254	missense	unknown
R8850:Dmbt1	UTSW	7	131090404	missense	unknown
R8852:Dmbt1	UTSW	7	131041123	missense	unknown
R8871:Dmbt1	UTSW	7	131116868	missense	unknown
R8943:Dmbt1	UTSW	7	131119643	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	131037881	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	131112069	missense	unknown
R9020:Dmbt1	UTSW	7	131111058	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	131116689	missense	unknown
R9230:Dmbt1	UTSW	7	131037912	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	131099125	missense	unknown
R9377:Dmbt1	UTSW	7	131093102	missense	unknown
R9428:Dmbt1	UTSW	7	131066478	missense	unknown
R9474:Dmbt1	UTSW	7	131074257	missense	unknown
R9573:Dmbt1	UTSW	7	131056180	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	131110923	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	131058285	missense	unknown
R9781:Dmbt1	UTSW	7	131037869	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	131112248	nonsense	probably null
X0062:Dmbt1	UTSW	7	131094851	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	131088812	missense	unknown
Z1177:Dmbt1	UTSW	7	131082485	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCACAAGTACAGGGGAC -3'
(R):5'- TCACGTGCACAGATGACTCC -3'

Sequencing Primer
(F):5'- ACACCTGACTATGGCATTGG -3'
(R):5'- GATGACTCCTGCATCCTCAGAATGG -3'

Posted On

2016-10-24