Incidental Mutation 'R5566:Olfr527'
ID436825
Institutional Source Beutler Lab
Gene Symbol Olfr527
Ensembl Gene ENSMUSG00000062782
Gene Nameolfactory receptor 527
SynonymsGA_x6K02T2PBJ9-42486061-42486978, MOR251-5
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140334017-140338551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140336067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 68 (D68E)
Ref Sequence ENSEMBL: ENSMUSP00000149080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]
Predicted Effect probably damaging
Transcript: ENSMUST00000172230
AA Change: D68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: D68E

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 179 9.1e-8 PFAM
Pfam:7tm_1 39 287 7.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214143
AA Change: D68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214858
AA Change: D68E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Olfr527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:Olfr527 APN 7 140336606 missense possibly damaging 0.90
IGL02885:Olfr527 APN 7 140336159 missense possibly damaging 0.94
R1340:Olfr527 UTSW 7 140336125 missense probably benign 0.10
R1711:Olfr527 UTSW 7 140335999 missense possibly damaging 0.55
R1860:Olfr527 UTSW 7 140336219 missense possibly damaging 0.78
R2042:Olfr527 UTSW 7 140335937 missense probably damaging 1.00
R2072:Olfr527 UTSW 7 140336653 missense possibly damaging 0.85
R2128:Olfr527 UTSW 7 140336429 missense probably damaging 1.00
R2347:Olfr527 UTSW 7 140336147 missense probably damaging 0.98
R2449:Olfr527 UTSW 7 140336432 missense probably benign
R2973:Olfr527 UTSW 7 140336387 missense probably damaging 1.00
R3151:Olfr527 UTSW 7 140336330 missense probably benign 0.01
R4320:Olfr527 UTSW 7 140336306 missense possibly damaging 0.94
R5561:Olfr527 UTSW 7 140336152 nonsense probably null
R5891:Olfr527 UTSW 7 140336600 missense probably benign 0.06
R7227:Olfr527 UTSW 7 140335621 start gained probably benign
R7296:Olfr527 UTSW 7 140336741 missense possibly damaging 0.91
R7568:Olfr527 UTSW 7 140335982 missense probably damaging 1.00
R8000:Olfr527 UTSW 7 140336342 missense possibly damaging 0.61
R8171:Olfr527 UTSW 7 140336230 missense probably damaging 1.00
R8203:Olfr527 UTSW 7 140336026 missense probably benign 0.14
R8351:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
R8451:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGATTCTCAGAAATGCC -3'
(R):5'- GACAATGCCAGCCAGGAATG -3'

Sequencing Primer
(F):5'- TGGGATTCTCAGAAATGCCTCACC -3'
(R):5'- GGCCCATCCAAGCACTGTAG -3'
Posted On2016-10-24