Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Nfat5'

436828

Institutional Source

Beutler Lab

Gene Symbol

Nfat5

Ensembl Gene

ENSMUSG00000003847

Gene Name

nuclear factor of activated T cells 5

Synonyms

OREBP, nfatz, TonEBP, B130038B15Rik

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R5566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107293470-107379517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107369135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 817 (M817K)

Ref Sequence

ENSEMBL: ENSMUSP00000122871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000144100] [ENSMUST00000147588] [ENSMUST00000151114] [ENSMUST00000154474] [ENSMUST00000169453]

AlphaFold

Q9WV30

Predicted Effect

probably benign
Transcript: ENSMUST00000075922

SMART Domains

Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847

Domain	Start	End	E-Value	Type
low complexity region	52	98	N/A	INTRINSIC
low complexity region	179	192	N/A	INTRINSIC
Pfam:RHD	282	439	7.8e-23	PFAM
IPT	444	542	3.33e-15	SMART
low complexity region	647	653	N/A	INTRINSIC
low complexity region	734	754	N/A	INTRINSIC
low complexity region	793	810	N/A	INTRINSIC
low complexity region	898	910	N/A	INTRINSIC
low complexity region	915	920	N/A	INTRINSIC
low complexity region	963	977	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077440
AA Change: M1242K

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: M1242K

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
low complexity region	103	116	N/A	INTRINSIC
Pfam:RHD	206	363	1.5e-22	PFAM
IPT	368	466	3.33e-15	SMART
low complexity region	571	577	N/A	INTRINSIC
low complexity region	658	678	N/A	INTRINSIC
low complexity region	717	734	N/A	INTRINSIC
low complexity region	822	834	N/A	INTRINSIC
low complexity region	839	844	N/A	INTRINSIC
low complexity region	887	901	N/A	INTRINSIC
internal_repeat_2	927	1110	7.13e-8	PROSPERO
internal_repeat_1	935	1128	2.59e-11	PROSPERO
internal_repeat_2	1122	1324	7.13e-8	PROSPERO
internal_repeat_1	1207	1426	2.59e-11	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000125721
AA Change: M1318K

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: M1318K

Domain	Start	End	E-Value	Type
low complexity region	52	98	N/A	INTRINSIC
low complexity region	179	192	N/A	INTRINSIC
Pfam:RHD	282	439	1e-22	PFAM
IPT	444	542	3.33e-15	SMART
low complexity region	647	653	N/A	INTRINSIC
low complexity region	734	754	N/A	INTRINSIC
low complexity region	793	810	N/A	INTRINSIC
low complexity region	898	910	N/A	INTRINSIC
low complexity region	915	920	N/A	INTRINSIC
low complexity region	963	977	N/A	INTRINSIC
internal_repeat_2	1003	1186	2.22e-8	PROSPERO
internal_repeat_1	1011	1204	5.31e-12	PROSPERO
internal_repeat_2	1198	1400	2.22e-8	PROSPERO
internal_repeat_1	1283	1502	5.31e-12	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126397

Predicted Effect

probably benign
Transcript: ENSMUST00000133026

SMART Domains

Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

Domain	Start	End	E-Value	Type
low complexity region	70	88	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144100

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147588
AA Change: M817K

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122871
Gene: ENSMUSG00000003847
AA Change: M817K

Domain	Start	End	E-Value	Type
Blast:IPT	1	42	3e-20	BLAST
PDB:1IMH\|D	1	44	2e-20	PDB
SCOP:d1bfta_	1	44	3e-14	SMART
low complexity region	146	152	N/A	INTRINSIC
low complexity region	233	253	N/A	INTRINSIC
low complexity region	292	309	N/A	INTRINSIC
low complexity region	397	409	N/A	INTRINSIC
low complexity region	414	419	N/A	INTRINSIC
low complexity region	462	476	N/A	INTRINSIC
internal_repeat_2	502	685	1.17e-6	PROSPERO
internal_repeat_1	510	703	1.39e-9	PROSPERO
internal_repeat_2	697	899	1.17e-6	PROSPERO
internal_repeat_1	782	1001	1.39e-9	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000151114
AA Change: M1336K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: M1336K

Domain	Start	End	E-Value	Type
low complexity region	70	116	N/A	INTRINSIC
low complexity region	197	210	N/A	INTRINSIC
Pfam:RHD_DNA_bind	300	457	1.1e-22	PFAM
IPT	462	560	3.33e-15	SMART
low complexity region	665	671	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	811	828	N/A	INTRINSIC
low complexity region	916	928	N/A	INTRINSIC
low complexity region	933	938	N/A	INTRINSIC
low complexity region	981	995	N/A	INTRINSIC
internal_repeat_2	1021	1204	2.24e-8	PROSPERO
internal_repeat_1	1029	1222	5.32e-12	PROSPERO
internal_repeat_2	1216	1418	2.24e-8	PROSPERO
internal_repeat_1	1301	1520	5.32e-12	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000154474

SMART Domains

Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

Domain	Start	End	E-Value	Type
low complexity region	52	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169453
AA Change: M1336K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: M1336K

Domain	Start	End	E-Value	Type
low complexity region	70	116	N/A	INTRINSIC
low complexity region	197	210	N/A	INTRINSIC
Pfam:RHD_DNA_bind	300	457	1.1e-22	PFAM
IPT	462	560	3.33e-15	SMART
low complexity region	665	671	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	811	828	N/A	INTRINSIC
low complexity region	916	928	N/A	INTRINSIC
low complexity region	933	938	N/A	INTRINSIC
low complexity region	981	995	N/A	INTRINSIC
internal_repeat_2	1021	1204	2.24e-8	PROSPERO
internal_repeat_1	1029	1222	5.32e-12	PROSPERO
internal_repeat_2	1216	1418	2.24e-8	PROSPERO
internal_repeat_1	1301	1520	5.32e-12	PROSPERO

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Nfat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Nfat5	APN	8	107367514	missense	probably damaging	1.00
IGL01145:Nfat5	APN	8	107367215	missense	probably damaging	0.99
IGL01700:Nfat5	APN	8	107339130	missense	probably damaging	0.99
IGL01721:Nfat5	APN	8	107344979	critical splice donor site	probably null
IGL01796:Nfat5	APN	8	107367641	missense	probably damaging	1.00
IGL01976:Nfat5	APN	8	107367559	missense	probably damaging	1.00
IGL02063:Nfat5	APN	8	107361818	missense	probably benign	0.03
IGL02150:Nfat5	APN	8	107367952	nonsense	probably null
IGL02174:Nfat5	APN	8	107339051	missense	probably damaging	1.00
IGL02224:Nfat5	APN	8	107344815	missense	probably benign	0.00
IGL02226:Nfat5	APN	8	107351522	nonsense	probably null
IGL02324:Nfat5	APN	8	107366176	splice site	probably benign
IGL02724:Nfat5	APN	8	107358735	missense	probably damaging	0.97
fettfeld	UTSW	8	107347727	missense	probably damaging	1.00
Grunefeld	UTSW	8	107355508	splice site	probably null
Kleinfeld	UTSW	8	107351438	missense	probably damaging	1.00
Lisa	UTSW	8	107347689	missense	probably damaging	1.00
viola	UTSW	8	107358668	missense	probably damaging	1.00
H8562:Nfat5	UTSW	8	107339382	splice site	probably benign
R0003:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0117:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0118:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0119:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0135:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0138:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0141:Nfat5	UTSW	8	107339075	missense	probably damaging	1.00
R0302:Nfat5	UTSW	8	107358701	missense	probably damaging	1.00
R0420:Nfat5	UTSW	8	107367461	missense	probably damaging	1.00
R0613:Nfat5	UTSW	8	107366295	missense	possibly damaging	0.83
R0691:Nfat5	UTSW	8	107355605	missense	probably damaging	1.00
R0743:Nfat5	UTSW	8	107368066	missense	probably damaging	1.00
R1329:Nfat5	UTSW	8	107369027	missense	probably benign	0.42
R1550:Nfat5	UTSW	8	107370573	missense	probably damaging	0.99
R1590:Nfat5	UTSW	8	107293890	missense	probably damaging	1.00
R1778:Nfat5	UTSW	8	107361789	missense	probably damaging	1.00
R1827:Nfat5	UTSW	8	107367334	missense	probably benign	0.00
R1918:Nfat5	UTSW	8	107366236	missense	probably damaging	0.97
R2679:Nfat5	UTSW	8	107344914	missense	probably damaging	1.00
R2850:Nfat5	UTSW	8	107293860	missense	probably damaging	1.00
R3703:Nfat5	UTSW	8	107351421	splice site	probably benign
R3966:Nfat5	UTSW	8	107367289	missense	possibly damaging	0.47
R4301:Nfat5	UTSW	8	107355695	intron	probably benign
R4596:Nfat5	UTSW	8	107351500	missense	possibly damaging	0.93
R4602:Nfat5	UTSW	8	107367223	nonsense	probably null
R4627:Nfat5	UTSW	8	107369276	missense	probably damaging	1.00
R4917:Nfat5	UTSW	8	107324652	missense	probably damaging	1.00
R4918:Nfat5	UTSW	8	107324652	missense	probably damaging	1.00
R5089:Nfat5	UTSW	8	107351438	missense	probably damaging	1.00
R5495:Nfat5	UTSW	8	107368447	missense	probably benign	0.03
R5851:Nfat5	UTSW	8	107347727	missense	probably damaging	1.00
R6012:Nfat5	UTSW	8	107367133	missense	probably benign	0.09
R6018:Nfat5	UTSW	8	107355651	critical splice donor site	probably null
R6364:Nfat5	UTSW	8	107368277	missense	probably benign	0.00
R6404:Nfat5	UTSW	8	107370588	missense	probably benign	0.01
R6466:Nfat5	UTSW	8	107355508	splice site	probably null
R7056:Nfat5	UTSW	8	107368106	missense	probably damaging	1.00
R7105:Nfat5	UTSW	8	107369191	missense	possibly damaging	0.88
R7128:Nfat5	UTSW	8	107358691	missense	probably benign	0.10
R7214:Nfat5	UTSW	8	107293883	missense	probably damaging	0.99
R7276:Nfat5	UTSW	8	107367099	missense	probably benign	0.25
R7560:Nfat5	UTSW	8	107370589	missense	probably benign	0.15
R7844:Nfat5	UTSW	8	107358668	missense	probably damaging	1.00
R7993:Nfat5	UTSW	8	107355502	splice site	probably null
R8407:Nfat5	UTSW	8	107367415	nonsense	probably null
R8428:Nfat5	UTSW	8	107368520	missense	probably damaging	0.96
R8798:Nfat5	UTSW	8	107347689	missense	probably damaging	1.00
R8919:Nfat5	UTSW	8	107368596	missense	probably damaging	0.99
R9067:Nfat5	UTSW	8	107367904	missense	probably benign	0.07
R9123:Nfat5	UTSW	8	107351509	missense	probably damaging	0.97
R9226:Nfat5	UTSW	8	107368769	missense	probably damaging	1.00
R9351:Nfat5	UTSW	8	107339278	missense	probably damaging	1.00
X0022:Nfat5	UTSW	8	107347756	nonsense	probably null
Z1177:Nfat5	UTSW	8	107338842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAGTAACTCTCCATCCC -3'
(R):5'- GCAATGCAGACATGGATGCTG -3'

Sequencing Primer
(F):5'- TCCATCCCAGGAGCAGCAG -3'
(R):5'- AGAGGAAGAGTGTTACTTGCTGATC -3'

Posted On

2016-10-24