Incidental Mutation 'R5566:Cep57'
ID436830
Institutional Source Beutler Lab
Gene Symbol Cep57
Ensembl Gene ENSMUSG00000031922
Gene Namecentrosomal protein 57
Synonyms4931428M20Rik, Tsp57, 3110002L15Rik, 4921510P06Rik
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13807792-13827107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13821575 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 25 (R25S)
Ref Sequence ENSEMBL: ENSMUSP00000114665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034398] [ENSMUST00000124883] [ENSMUST00000134746] [ENSMUST00000142494] [ENSMUST00000144484] [ENSMUST00000147115] [ENSMUST00000148086] [ENSMUST00000150893]
Predicted Effect probably damaging
Transcript: ENSMUST00000034398
AA Change: R52S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034398
Gene: ENSMUSG00000031922
AA Change: R52S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 9.8e-67 PFAM
low complexity region 259 271 N/A INTRINSIC
Pfam:Cep57_MT_bd 348 420 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124883
SMART Domains Protein: ENSMUSP00000119081
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 4.7e-34 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134746
AA Change: R52S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116713
Gene: ENSMUSG00000031922
AA Change: R52S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 209 1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142494
AA Change: R52S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114749
Gene: ENSMUSG00000031922
AA Change: R52S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 3.3e-72 PFAM
low complexity region 259 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144484
SMART Domains Protein: ENSMUSP00000114940
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147115
AA Change: R52S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116931
Gene: ENSMUSG00000031922
AA Change: R52S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Cep57_CLD 68 245 2.1e-72 PFAM
low complexity region 254 275 N/A INTRINSIC
Pfam:Cep57_MT_bd 319 394 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148086
AA Change: R25S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114665
Gene: ENSMUSG00000031922
AA Change: R25S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 41 218 1e-71 PFAM
low complexity region 232 244 N/A INTRINSIC
Pfam:Cep57_MT_bd 318 393 6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148904
Predicted Effect probably benign
Transcript: ENSMUST00000150893
SMART Domains Protein: ENSMUSP00000115338
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 96 5.2e-37 PFAM
low complexity region 110 122 N/A INTRINSIC
Pfam:Cep57_MT_bd 196 271 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151878
SMART Domains Protein: ENSMUSP00000116847
Gene: ENSMUSG00000031922

DomainStartEndE-ValueType
Pfam:Cep57_CLD 1 133 1.6e-43 PFAM
low complexity region 147 159 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Cep57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Cep57 APN 9 13819016 missense probably damaging 1.00
IGL01712:Cep57 APN 9 13813417 missense possibly damaging 0.72
IGL01965:Cep57 APN 9 13821520 unclassified probably benign
IGL02250:Cep57 APN 9 13810643 missense probably damaging 1.00
IGL02378:Cep57 APN 9 13821546 nonsense probably null
IGL02943:Cep57 APN 9 13818853 splice site probably benign
IGL03244:Cep57 APN 9 13818387 nonsense probably null
R0082:Cep57 UTSW 9 13810876 unclassified probably benign
R0330:Cep57 UTSW 9 13816985 missense probably damaging 1.00
R0786:Cep57 UTSW 9 13809870 missense probably damaging 0.99
R0962:Cep57 UTSW 9 13808743 missense possibly damaging 0.48
R1037:Cep57 UTSW 9 13818979 missense possibly damaging 0.89
R1472:Cep57 UTSW 9 13821554 missense probably benign 0.03
R1773:Cep57 UTSW 9 13816068 missense probably damaging 1.00
R1776:Cep57 UTSW 9 13818874 missense probably damaging 0.99
R4162:Cep57 UTSW 9 13812633 splice site probably null
R4895:Cep57 UTSW 9 13816153 intron probably benign
R4942:Cep57 UTSW 9 13813427 missense probably damaging 0.96
R5310:Cep57 UTSW 9 13818868 missense probably damaging 1.00
R5996:Cep57 UTSW 9 13809879 missense probably damaging 0.99
R6058:Cep57 UTSW 9 13810761 missense possibly damaging 0.75
R7065:Cep57 UTSW 9 13818381 missense probably damaging 1.00
R7410:Cep57 UTSW 9 13818684 intron probably benign
R7421:Cep57 UTSW 9 13810673 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGTCTCAAAGTACTTTAGGTTCC -3'
(R):5'- CAATAAATAGTGGTTGGGTTCTCAGTC -3'

Sequencing Primer
(F):5'- GTTCAGCAGTCTACATGAAAAGC -3'
(R):5'- AGCTGAACCATCAAGGTC -3'
Posted On2016-10-24