Incidental Mutation 'R5566:Zpr1'
ID436833
Institutional Source Beutler Lab
Gene Symbol Zpr1
Ensembl Gene ENSMUSG00000032078
Gene NameZPR1 zinc finger
SynonymsZfp259, ZPR1
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5566 (G1)
Quality Score168
Status Not validated
Chromosome9
Chromosomal Location46273064-46282643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46281075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 399 (V399D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074957] [ENSMUST00000156440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034583
AA Change: V399D

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034583
Gene: ENSMUSG00000032078
AA Change: V399D

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 387 1.56e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074957
SMART Domains Protein: ENSMUSP00000074490
Gene: ENSMUSG00000032077

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
internal_repeat_1 122 182 5.18e-30 PROSPERO
internal_repeat_1 174 234 5.18e-30 PROSPERO
low complexity region 394 417 N/A INTRINSIC
low complexity region 420 434 N/A INTRINSIC
Pfam:Bud13 478 620 2.8e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114552
AA Change: V354D
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078
AA Change: V354D

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143511
Predicted Effect possibly damaging
Transcript: ENSMUST00000156440
AA Change: V428D

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078
AA Change: V428D

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the cytoplasm of quiescent cells but translocates to the nucleolus in proliferating cells. The encoded protein interacts with survival motor neuron protein (SMN1) to enhance pre-mRNA splicing and to induce neuronal differentiation and axonal growth. Defects in this gene or the SMN1 gene can cause spinal muscular atrophy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to form a normal trophectoderm and fail to expand the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Zpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02960:Zpr1 APN 9 46273551 missense probably damaging 0.97
R0077:Zpr1 UTSW 9 46273336 missense probably damaging 1.00
R0081:Zpr1 UTSW 9 46279697 missense probably damaging 0.99
R0674:Zpr1 UTSW 9 46275449 missense probably damaging 1.00
R2419:Zpr1 UTSW 9 46276192 splice site probably benign
R4956:Zpr1 UTSW 9 46274663 missense probably damaging 1.00
R4979:Zpr1 UTSW 9 46278342 missense probably benign 0.20
R6480:Zpr1 UTSW 9 46274711 missense probably benign 0.01
R6948:Zpr1 UTSW 9 46273641 critical splice donor site probably null
R7139:Zpr1 UTSW 9 46281059 missense probably damaging 1.00
R7366:Zpr1 UTSW 9 46273373 splice site probably null
R7996:Zpr1 UTSW 9 46273565 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGCATGTACAGGGGCTTGG -3'
(R):5'- CGTCAGTTCCCCACAGTAAC -3'

Sequencing Primer
(F):5'- GCTTGGGTTTGATACTAGCATACAC -3'
(R):5'- TAACAGATAACCCTGCAGTGTG -3'
Posted On2016-10-24