Incidental Mutation 'R5566:Herc1'
ID436834
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonymstbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location66350450-66508775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66465537 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 3125 (M3125K)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042824
AA Change: M3125K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: M3125K

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124969
Predicted Effect probably benign
Transcript: ENSMUST00000135159
SMART Domains Protein: ENSMUSP00000119991
Gene: ENSMUSG00000038664

DomainStartEndE-ValueType
low complexity region 118 134 N/A INTRINSIC
low complexity region 138 153 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 241 254 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
low complexity region 543 549 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Map3k5 T C 10: 20,110,719 V893A probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66483966 missense probably benign 0.02
IGL00159:Herc1 APN 9 66437682 missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66476120 missense probably benign
IGL00717:Herc1 APN 9 66485002 missense probably damaging 1.00
IGL00766:Herc1 APN 9 66450741 missense probably damaging 1.00
IGL00776:Herc1 APN 9 66421038 missense probably benign
IGL00987:Herc1 APN 9 66408052 missense probably benign 0.07
IGL01090:Herc1 APN 9 66469175 nonsense probably null
IGL01098:Herc1 APN 9 66461922 critical splice donor site probably null
IGL01106:Herc1 APN 9 66476438 splice site probably benign
IGL01120:Herc1 APN 9 66428880 missense probably benign
IGL01359:Herc1 APN 9 66439268 missense probably benign 0.01
IGL01360:Herc1 APN 9 66483699 missense probably benign
IGL01364:Herc1 APN 9 66399361 missense probably benign 0.00
IGL01470:Herc1 APN 9 66497636 missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66487060 missense probably damaging 1.00
IGL01825:Herc1 APN 9 66399807 missense probably benign 0.00
IGL01903:Herc1 APN 9 66386872 nonsense probably null
IGL01988:Herc1 APN 9 66488075 splice site probably benign
IGL02074:Herc1 APN 9 66450983 missense probably benign
IGL02089:Herc1 APN 9 66480869 missense probably damaging 1.00
IGL02177:Herc1 APN 9 66434511 missense probably benign
IGL02300:Herc1 APN 9 66476363 missense probably benign 0.01
IGL02304:Herc1 APN 9 66476414 missense probably benign 0.06
IGL02369:Herc1 APN 9 66492011 nonsense probably null
IGL02445:Herc1 APN 9 66433482 missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66497328 missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66399901 missense probably damaging 0.98
IGL02571:Herc1 APN 9 66434605 splice site probably benign
IGL02709:Herc1 APN 9 66497680 missense probably damaging 0.97
IGL02717:Herc1 APN 9 66371921 nonsense probably null
IGL02726:Herc1 APN 9 66441988 missense probably benign 0.37
IGL02733:Herc1 APN 9 66450992 missense probably benign
IGL02963:Herc1 APN 9 66388823 missense probably damaging 0.99
IGL03101:Herc1 APN 9 66487997 missense probably benign
IGL03193:Herc1 APN 9 66402680 missense probably benign
IGL03203:Herc1 APN 9 66388900 critical splice donor site probably null
IGL03216:Herc1 APN 9 66478946 missense probably benign 0.06
IGL03282:Herc1 APN 9 66451459 missense probably benign 0.05
IGL03295:Herc1 APN 9 66396703 missense possibly damaging 0.56
IGL03134:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66372207 missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66372389 missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66479009 missense probably damaging 1.00
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0052:Herc1 UTSW 9 66400156 missense probably damaging 0.99
R0114:Herc1 UTSW 9 66461846 missense probably damaging 0.99
R0129:Herc1 UTSW 9 66448075 missense probably damaging 1.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0132:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0158:Herc1 UTSW 9 66495921 nonsense probably null
R0333:Herc1 UTSW 9 66464699 splice site probably null
R0384:Herc1 UTSW 9 66481050 splice site probably benign
R0419:Herc1 UTSW 9 66446074 splice site probably benign
R0453:Herc1 UTSW 9 66399772 missense probably benign 0.20
R0458:Herc1 UTSW 9 66476381 missense probably benign 0.12
R0490:Herc1 UTSW 9 66484999 missense probably damaging 1.00
R0506:Herc1 UTSW 9 66448159 missense probably damaging 0.99
R0513:Herc1 UTSW 9 66445645 missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66450881 missense probably benign 0.35
R0666:Herc1 UTSW 9 66484888 splice site probably benign
R0674:Herc1 UTSW 9 66501192 missense probably damaging 0.99
R0682:Herc1 UTSW 9 66481981 missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66386838 nonsense probably null
R0701:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R0766:Herc1 UTSW 9 66504840 missense probably damaging 1.00
R0850:Herc1 UTSW 9 66466670 missense probably damaging 1.00
R0907:Herc1 UTSW 9 66433428 missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66372145 missense probably damaging 1.00
R0976:Herc1 UTSW 9 66439878 missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66455968 missense probably benign
R1200:Herc1 UTSW 9 66486124 missense probably damaging 1.00
R1226:Herc1 UTSW 9 66416263 missense probably benign 0.00
R1364:Herc1 UTSW 9 66400093 missense probably damaging 1.00
R1395:Herc1 UTSW 9 66439181 missense probably benign 0.13
R1432:Herc1 UTSW 9 66465469 missense probably benign 0.13
R1440:Herc1 UTSW 9 66467803 missense probably damaging 1.00
R1476:Herc1 UTSW 9 66508266 missense probably damaging 1.00
R1590:Herc1 UTSW 9 66491953 splice site probably benign
R1634:Herc1 UTSW 9 66473538 missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66450678 splice site probably null
R1753:Herc1 UTSW 9 66469010 missense probably damaging 1.00
R1753:Herc1 UTSW 9 66502084 critical splice donor site probably null
R1796:Herc1 UTSW 9 66388856 nonsense probably null
R1830:Herc1 UTSW 9 66497599 missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66391426 missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66450791 missense probably damaging 1.00
R1894:Herc1 UTSW 9 66479461 missense probably damaging 1.00
R1918:Herc1 UTSW 9 66476126 splice site probably null
R1999:Herc1 UTSW 9 66486078 missense probably benign 0.07
R2034:Herc1 UTSW 9 66441972 missense probably benign 0.01
R2138:Herc1 UTSW 9 66470307 missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66439901 missense probably benign 0.45
R2192:Herc1 UTSW 9 66465406 missense probably damaging 0.99
R2312:Herc1 UTSW 9 66508281 nonsense probably null
R2338:Herc1 UTSW 9 66428969 missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66483935 missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3733:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3917:Herc1 UTSW 9 66434466 missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66433793 nonsense probably null
R4073:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4075:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4241:Herc1 UTSW 9 66448348 frame shift probably null
R4260:Herc1 UTSW 9 66448348 frame shift probably null
R4261:Herc1 UTSW 9 66448348 frame shift probably null
R4300:Herc1 UTSW 9 66489406 missense probably damaging 1.00
R4398:Herc1 UTSW 9 66479453 missense probably benign 0.13
R4426:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4427:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4590:Herc1 UTSW 9 66437664 missense probably damaging 0.97
R4630:Herc1 UTSW 9 66433714 splice site probably null
R4656:Herc1 UTSW 9 66394711 missense probably damaging 0.97
R4658:Herc1 UTSW 9 66479491 missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66433378 missense probably damaging 0.98
R4675:Herc1 UTSW 9 66391458 missense probably damaging 1.00
R4678:Herc1 UTSW 9 66416269 missense probably benign 0.00
R4754:Herc1 UTSW 9 66501206 missense probably benign 0.00
R4766:Herc1 UTSW 9 66441929 missense probably benign 0.00
R4792:Herc1 UTSW 9 66495984 missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66497343 splice site probably null
R4832:Herc1 UTSW 9 66495971 missense probably benign 0.11
R4879:Herc1 UTSW 9 66462837 nonsense probably null
R4948:Herc1 UTSW 9 66484902 missense probably benign
R5021:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66486126 missense probably benign 0.03
R5027:Herc1 UTSW 9 66473529 missense probably benign 0.01
R5027:Herc1 UTSW 9 66504618 missense probably damaging 0.98
R5038:Herc1 UTSW 9 66476460 intron probably benign
R5041:Herc1 UTSW 9 66429045 missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66448223 missense probably benign
R5197:Herc1 UTSW 9 66448504 missense probably damaging 0.99
R5207:Herc1 UTSW 9 66399869 nonsense probably null
R5247:Herc1 UTSW 9 66434551 missense probably benign 0.01
R5267:Herc1 UTSW 9 66461809 missense probably damaging 1.00
R5274:Herc1 UTSW 9 66399409 missense probably benign
R5375:Herc1 UTSW 9 66467887 missense probably damaging 0.99
R5401:Herc1 UTSW 9 66502056 missense probably damaging 1.00
R5560:Herc1 UTSW 9 66451119 missense probably benign 0.02
R5577:Herc1 UTSW 9 66481981 missense probably damaging 0.99
R5596:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66465435 missense probably damaging 1.00
R5744:Herc1 UTSW 9 66508193 missense probably damaging 1.00
R5802:Herc1 UTSW 9 66462878 missense probably damaging 1.00
R5822:Herc1 UTSW 9 66445612 missense probably benign 0.00
R5954:Herc1 UTSW 9 66451492 splice site probably benign
R5977:Herc1 UTSW 9 66433322 missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66483685 missense probably damaging 1.00
R6043:Herc1 UTSW 9 66408154 missense probably benign
R6046:Herc1 UTSW 9 66445549 missense probably damaging 0.99
R6089:Herc1 UTSW 9 66445532 missense probably damaging 1.00
R6123:Herc1 UTSW 9 66497250 missense probably damaging 0.97
R6155:Herc1 UTSW 9 66433423 missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66376381 missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66433788 missense probably damaging 1.00
R6265:Herc1 UTSW 9 66372016 missense probably benign 0.05
R6348:Herc1 UTSW 9 66487976 missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66471908 missense probably damaging 1.00
R6394:Herc1 UTSW 9 66395059 missense probably damaging 0.99
R6434:Herc1 UTSW 9 66486182 missense probably damaging 0.99
R6483:Herc1 UTSW 9 66448529 missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66418567 missense probably benign 0.02
R6633:Herc1 UTSW 9 66439252 nonsense probably null
R6634:Herc1 UTSW 9 66437744 missense probably benign
R6693:Herc1 UTSW 9 66478976 missense probably damaging 0.99
R6695:Herc1 UTSW 9 66483866 splice site probably null
R6748:Herc1 UTSW 9 66501188 frame shift probably null
R6750:Herc1 UTSW 9 66501188 frame shift probably null
R6751:Herc1 UTSW 9 66501188 frame shift probably null
R6774:Herc1 UTSW 9 66501188 frame shift probably null
R6785:Herc1 UTSW 9 66501188 frame shift probably null
R6786:Herc1 UTSW 9 66501188 frame shift probably null
R6856:Herc1 UTSW 9 66397898 missense probably benign 0.05
R6966:Herc1 UTSW 9 66411065 missense probably benign 0.07
R7020:Herc1 UTSW 9 66486078 missense probably benign 0.07
R7109:Herc1 UTSW 9 66481889 missense probably benign 0.03
R7122:Herc1 UTSW 9 66399774 missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66385032 missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66467499 missense probably damaging 0.98
R7303:Herc1 UTSW 9 66450816 missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66461868 missense
R7438:Herc1 UTSW 9 66394756 missense probably benign 0.00
R7535:Herc1 UTSW 9 66474853 missense probably damaging 1.00
R7585:Herc1 UTSW 9 66445547 missense probably damaging 1.00
R7603:Herc1 UTSW 9 66451383 nonsense probably null
R7670:Herc1 UTSW 9 66416347 missense probably damaging 0.99
R7705:Herc1 UTSW 9 66439834 missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66371876 missense probably benign 0.24
R7730:Herc1 UTSW 9 66493190 small deletion probably benign
R7880:Herc1 UTSW 9 66508224 missense probably damaging 0.99
R7958:Herc1 UTSW 9 66486193 missense probably damaging 1.00
R7976:Herc1 UTSW 9 66434270 missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66445560 nonsense probably null
R8084:Herc1 UTSW 9 66475935 missense probably benign 0.45
R8094:Herc1 UTSW 9 66493180 missense probably damaging 0.98
R8099:Herc1 UTSW 9 66372140 missense probably damaging 1.00
R8151:Herc1 UTSW 9 66433791 missense probably damaging 0.98
R8159:Herc1 UTSW 9 66461721 missense probably null
R8190:Herc1 UTSW 9 66418451 missense probably benign 0.00
R8213:Herc1 UTSW 9 66450888 missense probably damaging 0.99
R8230:Herc1 UTSW 9 66470316 missense probably damaging 0.99
R8265:Herc1 UTSW 9 66386704 nonsense probably null
R8270:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R8423:Herc1 UTSW 9 66508160 missense probably damaging 0.99
R8506:Herc1 UTSW 9 66473581 missense possibly damaging 0.52
RF023:Herc1 UTSW 9 66458334 missense
X0011:Herc1 UTSW 9 66400159 missense probably benign 0.28
X0067:Herc1 UTSW 9 66448524 missense probably benign 0.03
Z1176:Herc1 UTSW 9 66434576 missense probably benign
Z1177:Herc1 UTSW 9 66458425 missense probably null
Z1177:Herc1 UTSW 9 66471911 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAATGTTAGCCGAACTATGCCATG -3'
(R):5'- ATGGCCAAAGAGACTTGCTGG -3'

Sequencing Primer
(F):5'- GCCGAACTATGCCATGTTTATATTC -3'
(R):5'- CCAAAGAGACTTGCTGGTATGAAGTG -3'
Posted On2016-10-24