Incidental Mutation 'R5566:Mtmr4'
ID 436848
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE-DSP2, ESTM44, FYVE zinc finger phosphatase
MMRRC Submission 043123-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R5566 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87482988-87507128 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87495356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 471 (L471P)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628] [ENSMUST00000134216]
AlphaFold Q91XS1
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: L471P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: L471P

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: L471P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: L471P

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: L471P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: L471P

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134216
SMART Domains Protein: ENSMUSP00000119660
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 140 204 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,244,615 (GRCm39) Y2159* probably null Het
Abca3 A G 17: 24,602,901 (GRCm39) T499A probably benign Het
Abcb5 T A 12: 118,899,702 (GRCm39) T322S probably damaging Het
Adamts4 T A 1: 171,078,419 (GRCm39) M1K probably null Het
Adamtsl4 C T 3: 95,592,765 (GRCm39) probably null Het
Adh4 A T 3: 138,129,950 (GRCm39) I259F probably damaging Het
Aff3 G A 1: 38,220,505 (GRCm39) S1135F probably damaging Het
Arhgef16 T C 4: 154,370,105 (GRCm39) D280G probably benign Het
Baiap3 T C 17: 25,470,707 (GRCm39) E71G probably damaging Het
Calb2 A G 8: 110,879,332 (GRCm39) I91T possibly damaging Het
Ccr5 A G 9: 123,924,697 (GRCm39) N100S probably benign Het
Cep57 G T 9: 13,732,871 (GRCm39) R25S probably damaging Het
Chadl A G 15: 81,580,079 (GRCm39) L52P probably damaging Het
Clec12b T C 6: 129,362,438 (GRCm39) T6A probably damaging Het
Cnga1 T A 5: 72,775,593 (GRCm39) N43Y probably damaging Het
Col20a1 A T 2: 180,628,316 (GRCm39) probably null Het
Csmd2 T C 4: 128,356,682 (GRCm39) probably null Het
Ctps1 A T 4: 120,411,300 (GRCm39) probably null Het
Cyp39a1 T A 17: 43,996,099 (GRCm39) W224R possibly damaging Het
Defb29 A T 2: 152,380,848 (GRCm39) Y54N probably benign Het
Dmbt1 A T 7: 130,708,003 (GRCm39) D1241V probably damaging Het
Dnah1 A T 14: 30,996,323 (GRCm39) I2671K probably benign Het
Dnah2 C A 11: 69,407,395 (GRCm39) E158* probably null Het
Dynlt2b A G 16: 32,238,718 (GRCm39) Y31C probably damaging Het
Edar A G 10: 58,464,463 (GRCm39) S59P possibly damaging Het
Egr2 T A 10: 67,376,596 (GRCm39) C339* probably null Het
Eif5b G A 1: 38,084,765 (GRCm39) V871I possibly damaging Het
Eif5b G A 1: 38,090,328 (GRCm39) G1169E probably damaging Het
Erap1 A G 13: 74,810,531 (GRCm39) Y290C probably damaging Het
Fastkd5 T A 2: 130,456,221 (GRCm39) T790S possibly damaging Het
Fkrp C T 7: 16,544,849 (GRCm39) V338M probably damaging Het
Gabra6 T C 11: 42,198,317 (GRCm39) T378A probably benign Het
Gm4924 C A 10: 82,214,475 (GRCm39) Q17K possibly damaging Het
Gm9847 A G 12: 14,545,000 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,543,919 (GRCm39) F429S probably damaging Het
Gpr162 G A 6: 124,837,901 (GRCm39) R250* probably null Het
Gtf2a1 A T 12: 91,534,368 (GRCm39) D295E possibly damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Herc1 T A 9: 66,372,819 (GRCm39) M3125K possibly damaging Het
Hoxb6 T A 11: 96,191,580 (GRCm39) Y167* probably null Het
Hrob T A 11: 102,146,659 (GRCm39) S312T probably damaging Het
Htt T C 5: 35,006,419 (GRCm39) Y1443H probably damaging Het
Il21r A G 7: 125,224,470 (GRCm39) D28G probably damaging Het
Impact T G 18: 13,107,819 (GRCm39) V29G probably damaging Het
Itpr3 A G 17: 27,334,926 (GRCm39) T2147A possibly damaging Het
Itsn2 T A 12: 4,676,554 (GRCm39) L50Q probably damaging Het
Jade1 A G 3: 41,559,338 (GRCm39) D473G possibly damaging Het
Kif26a T G 12: 112,123,788 (GRCm39) L131R probably damaging Het
Kif2a A T 13: 107,130,432 (GRCm39) M1K probably null Het
Lrsam1 C A 2: 32,831,870 (GRCm39) Q368H probably damaging Het
Macf1 T C 4: 123,328,957 (GRCm39) Q4592R probably damaging Het
Map3k5 T C 10: 19,986,465 (GRCm39) V893A probably damaging Het
Med13l G T 5: 118,866,730 (GRCm39) V595F possibly damaging Het
Mocs1 T A 17: 49,761,211 (GRCm39) L435Q possibly damaging Het
Myo7a T C 7: 97,714,023 (GRCm39) E1616G possibly damaging Het
Nacad T A 11: 6,552,136 (GRCm39) S352C probably damaging Het
Nfat5 T A 8: 108,095,767 (GRCm39) M817K possibly damaging Het
Ofcc1 C A 13: 40,248,129 (GRCm39) L668F probably damaging Het
Or12j2 C A 7: 139,915,980 (GRCm39) D68E probably damaging Het
Or7e178 T C 9: 20,225,265 (GRCm39) Q309R probably benign Het
Or8j3c G A 2: 86,253,721 (GRCm39) Q100* probably null Het
Plxnb2 T C 15: 89,048,223 (GRCm39) T696A probably benign Het
Prkab2 T A 3: 97,569,609 (GRCm39) F58L probably benign Het
Prpf4 G T 4: 62,334,206 (GRCm39) L220F probably benign Het
Rad18 A T 6: 112,658,307 (GRCm39) D199E probably benign Het
Raet1e T C 10: 22,050,304 (GRCm39) L29P probably damaging Het
Ralgapb A C 2: 158,336,630 (GRCm39) T1089P possibly damaging Het
Rest A G 5: 77,430,173 (GRCm39) E864G probably benign Het
Rgsl1 T A 1: 153,669,520 (GRCm39) I289F probably damaging Het
Rint1 T C 5: 24,015,951 (GRCm39) Y406H probably damaging Het
Rmc1 T C 18: 12,313,749 (GRCm39) I26T possibly damaging Het
Rpl31 C T 1: 39,409,108 (GRCm39) R41C probably benign Het
Scn8a T C 15: 100,872,415 (GRCm39) S485P probably damaging Het
Slamf1 T A 1: 171,615,538 (GRCm39) V249E possibly damaging Het
Slc39a12 C T 2: 14,412,414 (GRCm39) T362I possibly damaging Het
Sos1 C T 17: 80,761,319 (GRCm39) V126I possibly damaging Het
Srcap T C 7: 127,124,475 (GRCm39) F215S probably damaging Het
Supt4a T A 11: 87,634,113 (GRCm39) S110T probably benign Het
Tbc1d30 T A 10: 121,138,015 (GRCm39) T232S probably damaging Het
Tenm3 A G 8: 48,732,041 (GRCm39) C1288R probably damaging Het
Tespa1 T A 10: 130,191,356 (GRCm39) L100* probably null Het
Tgm1 C A 14: 55,949,893 (GRCm39) R105L probably damaging Het
Tgoln1 G A 6: 72,593,018 (GRCm39) T154I possibly damaging Het
Trp53i13 G A 11: 77,399,552 (GRCm39) T259I probably damaging Het
Tubgcp4 T A 2: 121,015,251 (GRCm39) F320I possibly damaging Het
Tut7 A T 13: 59,936,443 (GRCm39) C817* probably null Het
Vmn1r21 A C 6: 57,821,079 (GRCm39) Y122D probably benign Het
Vmn1r75 T A 7: 11,614,407 (GRCm39) D46E probably damaging Het
Vmn2r120 A T 17: 57,852,290 (GRCm39) L9M possibly damaging Het
Vmn2r59 A G 7: 41,696,247 (GRCm39) I165T possibly damaging Het
Vmn2r76 A T 7: 85,875,286 (GRCm39) Y564N probably damaging Het
Wee1 G T 7: 109,725,257 (GRCm39) E300* probably null Het
Xdh T C 17: 74,200,617 (GRCm39) D1168G probably damaging Het
Zfp54 A G 17: 21,653,706 (GRCm39) T67A probably damaging Het
Zfp941 G T 7: 140,392,679 (GRCm39) H227N probably benign Het
Zpr1 T A 9: 46,192,373 (GRCm39) V399D possibly damaging Het
Zzz3 A G 3: 152,161,461 (GRCm39) E285G probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87,502,750 (GRCm39) missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87,494,893 (GRCm39) missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87,493,230 (GRCm39) unclassified probably benign
IGL01544:Mtmr4 APN 11 87,488,437 (GRCm39) splice site probably benign
IGL01574:Mtmr4 APN 11 87,491,473 (GRCm39) missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87,494,976 (GRCm39) missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87,491,950 (GRCm39) missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87,505,060 (GRCm39) missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87,491,609 (GRCm39) missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87,488,519 (GRCm39) missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87,502,829 (GRCm39) missense possibly damaging 0.63
Hippie UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
incharge UTSW 11 87,501,868 (GRCm39) nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87,501,953 (GRCm39) missense probably benign
R0009:Mtmr4 UTSW 11 87,502,334 (GRCm39) missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87,489,714 (GRCm39) missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87,501,890 (GRCm39) missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87,502,266 (GRCm39) missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87,503,051 (GRCm39) missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87,504,342 (GRCm39) missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87,493,656 (GRCm39) missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87,502,943 (GRCm39) missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87,495,916 (GRCm39) missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87,501,793 (GRCm39) missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87,491,649 (GRCm39) missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87,495,823 (GRCm39) missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87,494,923 (GRCm39) missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87,501,868 (GRCm39) nonsense probably null
R5502:Mtmr4 UTSW 11 87,504,904 (GRCm39) missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87,495,875 (GRCm39) nonsense probably null
R5907:Mtmr4 UTSW 11 87,502,876 (GRCm39) missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87,494,977 (GRCm39) missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87,501,845 (GRCm39) missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87,504,353 (GRCm39) missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87,491,439 (GRCm39) missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87,495,431 (GRCm39) critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87,502,063 (GRCm39) missense probably benign
R7350:Mtmr4 UTSW 11 87,491,476 (GRCm39) missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87,495,383 (GRCm39) missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87,502,727 (GRCm39) missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87,502,702 (GRCm39) missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87,495,406 (GRCm39) missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87,488,550 (GRCm39) missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87,503,015 (GRCm39) missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87,489,690 (GRCm39) missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87,502,756 (GRCm39) nonsense probably null
R8544:Mtmr4 UTSW 11 87,502,735 (GRCm39) missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87,494,950 (GRCm39) missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87,493,626 (GRCm39) missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87,493,241 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,504,916 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,503,138 (GRCm39) missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87,494,962 (GRCm39) missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87,502,651 (GRCm39) missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87,502,706 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TAACGTGTTTACAGCTGCCAG -3'
(R):5'- CCGTAGAGACACGAGTATGTG -3'

Sequencing Primer
(F):5'- GGACATTCTCTTAGAAAGCTGGACC -3'
(R):5'- TCAGGACACGATTCTCCA -3'
Posted On 2016-10-24